Skip to content

add nirvana #9633

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Open
FriederikeHanssen wants to merge 15 commits into
base: master
Choose a base branch
from
Open

add nirvana #9633

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
15 commits
Select commit Hold shift + click to select a range
ad2d2e4
add nirvana
FriederikeHanssen Jan 9, 2026
72dbc40
adsnapshots
FriederikeHanssen Jan 9, 2026
0247f65
Merge branch 'master' into nirvana
FriederikeHanssen Jan 9, 2026
ade1a99
use content due to timestamp in file
FriederikeHanssen Jan 12, 2026
9a0c833
Merge remote-tracking branch 'origin/nirvana' into nirvana
FriederikeHanssen Jan 12, 2026
a58237d
test with only using the docker container
FriederikeHanssen Jan 12, 2026
e61dc58
test oras protocol. somehow dotnet is missing in the singularity cont…
FriederikeHanssen Jan 12, 2026
1af4b0f
use amd oras image
FriederikeHanssen Jan 12, 2026
2b25a5c
Update modules/nf-core/nirvana/main.nf
FriederikeHanssen Jan 12, 2026
bbaff86
test with symlink before pushing upstream
FriederikeHanssen Jan 12, 2026
daf8950
Merge remote-tracking branch 'origin/nirvana' into nirvana
FriederikeHanssen Jan 12, 2026
8e012af
Merge branch 'master' into nirvana
FriederikeHanssen Jan 12, 2026
d8b4bec
test new container
FriederikeHanssen Jan 13, 2026
2636961
merge upstream
FriederikeHanssen Jan 13, 2026
4ff25f7
remove symlinking shouldn't be necessary anymore
FriederikeHanssen Jan 13, 2026
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
7 changes: 7 additions & 0 deletions modules/nf-core/nirvana/environment.yml
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,7 @@
---
# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
channels:
- conda-forge
- bioconda
dependencies:
- bioconda::nirvana=3.18.1
43 changes: 43 additions & 0 deletions modules/nf-core/nirvana/main.nf
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,43 @@
process NIRVANA {
tag "${meta.id}"
label 'process_medium'

conda "${moduleDir}/environment.yml"
container 'community.wave.seqera.io/library/nirvana:3.18.1--51c5bd56fef22808'

input:
tuple val(meta) , path(vcf)
tuple val(meta2), path(reference)
tuple val(meta3), path(cache), val(cache_prefix)
Copy link
Contributor

@adamrtalbot adamrtalbot Jan 12, 2026

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Is the cache_prefix a path or a specific string within the path?

Copy link
Contributor Author

@FriederikeHanssen FriederikeHanssen Jan 12, 2026

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

If the data looks like this:

❯ tree
.
├── Cache
│   └── SARS-CoV-2
│       ├── SARS-CoV-2.polyphen.ndb
│       ├── SARS-CoV-2.sift.ndb
│       └── SARS-CoV-2.transcripts.ndb
├── References
│   └── SARS-CoV-2.ASM985889v3.dat
└── SupplementaryAnnotation
    └── SARS-CoV-2
        ├── SARS-COV-2_AllFreq.nsa
        ├── SARS-COV-2_AllFreq.nsa.idx
        ├── SARS-COV-2_AllFreq.nsa.schema
        ├── SARS-CoV-2_ProteinDomains.nsi
        └── SARS-CoV-2_ProteinDomains.nsi.schema

then the cache is ./Cache/SARS-CoV-2/ and thecache_prefix is SARS-CoV-2 (here the one that is the prefix of the filename), so it overall is resolved to ./Cache/SARS-CoV-2/SARS-CoV-2.

I am not certain we can enforce people to match the prefix on the actual files with the folder name. I have not seen more Nirvana caches to check how this normally looks like. Alternatively, we could possible stage in the files and somehow extract the cache prefix to build the path, but it feels brittle

Copy link
Contributor

@adamrtalbot adamrtalbot Jan 12, 2026

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Alternatively, we could possible stage in the files and somehow extract the cache prefix to build the path, but it feels brittle

I think we should do this at the workflow level, so I'm fine with this.

tuple val(meta4), path(supplementary_annotations)

output:
tuple val(meta), path("*.json.gz"), emit: json
tuple val(meta), path("*.json.gz.jsi"), emit: jsi
tuple val("${task.process}"), val('nirvana'), eval("Nirvana -v 2>&1 | awk '{print \$2}' | cut -d'-' -f1"), topic: versions, emit: versions_nirvana

when:
task.ext.when == null || task.ext.when

script:
def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
def cache_command = cache ? "-c ${cache}/${cache_prefix}" : ""
def sa_command = supplementary_annotations ? "--sd ${supplementary_annotations}" : ""
"""
Nirvana \\
-i ${vcf} \\
-r ${reference} \\
${cache_command} \\
${sa_command} \\
${args} \\
-o ${prefix}
"""

stub:
def prefix = task.ext.prefix ?: "${meta.id}"
"""
echo "" | gzip > ${prefix}.json.gz
touch ${prefix}.json.gz.jsi
"""
}
109 changes: 109 additions & 0 deletions modules/nf-core/nirvana/meta.yml
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,109 @@
# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json
name: "nirvana"
description: Clinical-grade annotation of genomic variants including SNVs, MNVs, insertions, deletions, indels, and SVs
keywords:
- annotation
- variant annotation
- vcf
- genomics
- clinical annotation
tools:
- "nirvana":
description: "Clinical-grade annotation of genomic variants (SNVs, MNVs, insertions,
deletions, indels, and SVs)"
homepage: "https://illumina.github.io/NirvanaDocumentation/"
documentation: "https://illumina.github.io/NirvanaDocumentation/"
tool_dev_url: "https://github.com/Illumina/Nirvana"
licence: ["GPL v3"]
identifier: biotools:nirvana

input:
- - meta:
type: map
description: |
Groovy Map containing sample information
e.g. `[ id:'sample1' ]`
- vcf:
type: file
description: Input VCF file to annotate
pattern: "*.{vcf,vcf.gz}"
ontologies:
- edam: "http://edamontology.org/format_3016" # VCF
- - meta2:
type: map
description: |
Groovy Map containing reference information
e.g. `[ id:'genome' ]`
- reference:
type: file
description: Compressed Nirvana reference sequence file
pattern: "*.dat"
- - meta3:
type: map
description: |
Groovy Map containing cache information
e.g. `[ id:'cache' ]`
- cache:
type: directory
description: Nirvana cache directory
- cache_prefix:
type: string
description: Prefix for cache files (e.g., 'SARS-CoV-2' for files like SARS-CoV-2.transcripts.ndb)
- - meta4:
type: map
description: |
Groovy Map containing supplementary annotation information
e.g. `[ id:'sa' ]`
- supplementary_annotations:
type: directory
description: Nirvana supplementary annotation directory (optional)

output:
json:
- - meta:
type: map
description: |
Groovy Map containing sample information
e.g. `[ id:'sample1' ]`
- "*.json.gz":
type: file
description: Gzip-compressed JSON file with variant annotations
pattern: "*.json.gz"
ontologies:
- edam: "http://edamontology.org/format_3464" # JSON
jsi:
- - meta:
type: map
description: |
Groovy Map containing sample information
e.g. `[ id:'sample1' ]`
- "*.json.gz.jsi":
type: file
description: JSON index file for the annotations
pattern: "*.json.gz.jsi"
versions_nirvana:
- - "${task.process}":
type: string
description: The name of the process
- "nirvana":
type: string
description: The name of the tool
- "Nirvana -v 2>&1 | awk '{print $2}' | cut -d'-' -f1":
type: eval
description: The expression to obtain the version of the tool

topics:
versions:
- - ${task.process}:
type: string
description: The name of the process
- nirvana:
type: string
description: The name of the tool
- "Nirvana -v 2>&1 | awk '{print $2}' | cut -d'-' -f1":
type: eval
description: The expression to obtain the version of the tool
authors:
- "@FriederikeHanssen"
maintainers:
- "@FriederikeHanssen"
108 changes: 108 additions & 0 deletions modules/nf-core/nirvana/tests/main.nf.test
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,108 @@
nextflow_process {

name "Test Process NIRVANA"
script "../main.nf"
process "NIRVANA"

tag "modules"
tag "modules_nfcore"
tag "nirvana"
tag "untar"

setup {
run("UNTAR", alias: "UNTAR_CACHE") {
script "../../untar/main.nf"
process {
"""
input[0] = [
[ id:'Cache' ],
file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/Cache.tar', checkIfExists: true)
]
"""
}
}

run("UNTAR", alias: "UNTAR_SA") {
script "../../untar/main.nf"
process {
"""
input[0] = [
[ id:'SupplementaryAnnotation' ],
file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/SupplementaryAnnotation.tar', checkIfExists: true)
]
"""
}
}
}

test("sarscov2 - vcf") {

when {
process {
"""
input[0] = [
[ id:'test' ],
file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)
]
input[1] = [
[ id:'reference' ],
file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/SARS-CoV-2.ASM985889v3.dat', checkIfExists: true)
]
input[2] = UNTAR_CACHE.out.untar.map { meta, dir ->
[ meta, dir, 'SARS-CoV-2' ]
}
input[3] = UNTAR_SA.out.untar
"""
}
}

then {
assertAll(
{ assert process.success },
// Remove creationTime field from JSON and snapshot the rest
{ assert snapshot(
path(process.out.json[0][1]).linesGzip.collect {
it.replaceAll(/"creationTime":"[^"]*",?/, '')
}
).match("json_content") },
// Just check JSI exists
{ assert path(process.out.jsi[0][1]).exists() },
{ assert snapshot(process.out.versions_nirvana).match() }
)
}

}

test("sarscov2 - vcf - stub") {

options "-stub"

when {
process {
"""
input[0] = [
[ id:'test' ],
file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)
]
input[1] = [
[ id:'reference' ],
file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/SARS-CoV-2.ASM985889v3.dat', checkIfExists: true)
]
input[2] = UNTAR_CACHE.out.untar.map { meta, dir ->
[ meta, dir, 'SARS-CoV-2' ]
}
input[3] = UNTAR_SA.out.untar
"""
}
}

then {
assertAll(
{ assert process.success },
{ assert snapshot(process.out).match() }
)
}

}

}
97 changes: 97 additions & 0 deletions modules/nf-core/nirvana/tests/main.nf.test.snap
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,97 @@
{
"json_content": {
"content": [
[
"{\"header\":{\"annotator\":\"Nirvana 3.18.1\",\"genomeAssembly\":\"SARSCoV2\",\"schemaVersion\":6,\"dataVersion\":\"0.27.66\",\"dataSources\":[{\"name\":\"RefSeq\",\"version\":\"NC_045512.2\",\"description\":\"Severe acute respiratory syndrome coronavirus 2 (SARS-CoV2)\",\"releaseDate\":\"2020-03-20\"},{\"name\":\"alleleFrequency\",\"version\":\"SARS-COV-2_AllFreq.tsv\",\"releaseDate\":\"2020-05-08\"},{\"name\":\"proteinDomains\",\"version\":\"SARS-CoV-2_ProteinDomains.tsv\",\"releaseDate\":\"2020-05-08\"},{\"name\":\"MitochondrialHeteroplasmy\",\"version\":\"20180410\",\"description\":\"Variant read frequency percentiles for the Mitochondrial reference\",\"releaseDate\":\"2020-05-21\"}],\"samples\":[\"test\"]},\"positions\":[",
"{\"chromosome\":\"MT192765.1\",\"position\":197,\"refAllele\":\"G\",\"altAlleles\":[\"T\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-197-G-T\",\"chromosome\":\"MT192765.1\",\"begin\":197,\"end\":197,\"refAllele\":\"G\",\"altAllele\":\"T\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.197G>T\"}]},",
"{\"chromosome\":\"MT192765.1\",\"position\":4788,\"refAllele\":\"C\",\"altAlleles\":[\"T\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-4788-C-T\",\"chromosome\":\"MT192765.1\",\"begin\":4788,\"end\":4788,\"refAllele\":\"C\",\"altAllele\":\"T\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.4788C>T\"}]},",
"{\"chromosome\":\"MT192765.1\",\"position\":8236,\"refAllele\":\"C\",\"altAlleles\":[\"A\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-8236-C-A\",\"chromosome\":\"MT192765.1\",\"begin\":8236,\"end\":8236,\"refAllele\":\"C\",\"altAllele\":\"A\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.8236C>A\"}]},",
"{\"chromosome\":\"MT192765.1\",\"position\":10506,\"refAllele\":\"TTATGACTGTGTCTCTTTTTGTTACATGCACCATATG\",\"altAlleles\":[\"TTATG\"],\"quality\":18.4617,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"0/1\"}],\"variants\":[{\"vid\":\"MT192765.1-10510-NACTGTGTCTCTTTTTGTTACATGCACCATATG-N\",\"chromosome\":\"MT192765.1\",\"begin\":10511,\"end\":10542,\"refAllele\":\"ACTGTGTCTCTTTTTGTTACATGCACCATATG\",\"altAllele\":\"-\",\"variantType\":\"deletion\",\"hgvsg\":\"MT192765.1:g.10511_10542del\"}]},",
"{\"chromosome\":\"MT192765.1\",\"position\":11037,\"refAllele\":\"T\",\"altAlleles\":[\"C\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-11037-T-C\",\"chromosome\":\"MT192765.1\",\"begin\":11037,\"end\":11037,\"refAllele\":\"T\",\"altAllele\":\"C\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.11037T>C\"}]},",
"{\"chromosome\":\"MT192765.1\",\"position\":15009,\"refAllele\":\"G\",\"altAlleles\":[\"A\"],\"quality\":30.4183,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-15009-G-A\",\"chromosome\":\"MT192765.1\",\"begin\":15009,\"end\":15009,\"refAllele\":\"G\",\"altAllele\":\"A\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.15009G>A\"}]},",
"{\"chromosome\":\"MT192765.1\",\"position\":18807,\"refAllele\":\"T\",\"altAlleles\":[\"C\"],\"quality\":136,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-18807-T-C\",\"chromosome\":\"MT192765.1\",\"begin\":18807,\"end\":18807,\"refAllele\":\"T\",\"altAllele\":\"C\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.18807T>C\"}]},",
"{\"chromosome\":\"MT192765.1\",\"position\":23813,\"refAllele\":\"T\",\"altAlleles\":[\"C\"],\"quality\":4.3847,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-23813-T-C\",\"chromosome\":\"MT192765.1\",\"begin\":23813,\"end\":23813,\"refAllele\":\"T\",\"altAllele\":\"C\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.23813T>C\"}]},",
"{\"chromosome\":\"MT192765.1\",\"position\":24103,\"refAllele\":\"A\",\"altAlleles\":[\"G\"],\"quality\":30.4183,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-24103-A-G\",\"chromosome\":\"MT192765.1\",\"begin\":24103,\"end\":24103,\"refAllele\":\"A\",\"altAllele\":\"G\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.24103A>G\"}]}",
"]}"
]
],
"meta": {
"nf-test": "0.9.3",
"nextflow": "25.10.2"
},
"timestamp": "2026-01-12T09:27:01.830246"
},
"sarscov2 - vcf": {
"content": [
[
[
"NIRVANA",
"nirvana",
"Nirvana 3.18.1"
]
]
],
"meta": {
"nf-test": "0.9.3",
"nextflow": "25.10.2"
},
"timestamp": "2026-01-12T09:27:01.842455"
},
"sarscov2 - vcf - stub": {
"content": [
{
"0": [
[
{
"id": "test"
},
"test.json.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
],
"1": [
[
{
"id": "test"
},
"test.json.gz.jsi:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
"2": [
[
"NIRVANA",
"nirvana",
"Nirvana 3.18.1"
]
],
"jsi": [
[
{
"id": "test"
},
"test.json.gz.jsi:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
"json": [
[
{
"id": "test"
},
"test.json.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
],
"versions_nirvana": [
[
"NIRVANA",
"nirvana",
"Nirvana 3.18.1"
]
]
}
],
"meta": {
"nf-test": "0.9.3",
"nextflow": "25.10.2"
},
"timestamp": "2026-01-12T09:27:21.144398"
}
}
Loading