diff --git a/modules/nf-core/nirvana/environment.yml b/modules/nf-core/nirvana/environment.yml
new file mode 100644
index 000000000000..45854d1f9210
--- /dev/null
+++ b/modules/nf-core/nirvana/environment.yml
@@ -0,0 +1,7 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
+channels:
+  - conda-forge
+  - bioconda
+dependencies:
+  - bioconda::nirvana=3.18.1
diff --git a/modules/nf-core/nirvana/main.nf b/modules/nf-core/nirvana/main.nf
new file mode 100644
index 000000000000..9a62a954b589
--- /dev/null
+++ b/modules/nf-core/nirvana/main.nf
@@ -0,0 +1,43 @@
+process NIRVANA {
+    tag "${meta.id}"
+    label 'process_medium'
+
+    conda "${moduleDir}/environment.yml"
+    container  'community.wave.seqera.io/library/nirvana:3.18.1--51c5bd56fef22808'
+
+    input:
+    tuple val(meta) , path(vcf)
+    tuple val(meta2), path(reference)
+    tuple val(meta3), path(cache), val(cache_prefix)
+    tuple val(meta4), path(supplementary_annotations)
+
+    output:
+    tuple val(meta), path("*.json.gz"), emit: json
+    tuple val(meta), path("*.json.gz.jsi"), emit: jsi
+    tuple val("${task.process}"), val('nirvana'), eval("Nirvana -v 2>&1 | awk '{print \$2}' | cut -d'-' -f1"), topic: versions, emit: versions_nirvana
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def cache_command = cache ? "-c ${cache}/${cache_prefix}" : ""
+    def sa_command = supplementary_annotations ? "--sd ${supplementary_annotations}" : ""
+    """
+    Nirvana \\
+        -i ${vcf} \\
+        -r ${reference} \\
+        ${cache_command} \\
+        ${sa_command} \\
+        ${args} \\
+        -o ${prefix}
+    """
+
+    stub:
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    """
+    echo "" | gzip > ${prefix}.json.gz
+    touch ${prefix}.json.gz.jsi
+    """
+}
diff --git a/modules/nf-core/nirvana/meta.yml b/modules/nf-core/nirvana/meta.yml
new file mode 100644
index 000000000000..552f3729217e
--- /dev/null
+++ b/modules/nf-core/nirvana/meta.yml
@@ -0,0 +1,109 @@
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json
+name: "nirvana"
+description: Clinical-grade annotation of genomic variants including SNVs, MNVs, insertions, deletions, indels, and SVs
+keywords:
+  - annotation
+  - variant annotation
+  - vcf
+  - genomics
+  - clinical annotation
+tools:
+  - "nirvana":
+      description: "Clinical-grade annotation of genomic variants (SNVs, MNVs, insertions,
+        deletions, indels, and SVs)"
+      homepage: "https://illumina.github.io/NirvanaDocumentation/"
+      documentation: "https://illumina.github.io/NirvanaDocumentation/"
+      tool_dev_url: "https://github.com/Illumina/Nirvana"
+      licence: ["GPL v3"]
+      identifier: biotools:nirvana
+
+input:
+  - - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. `[ id:'sample1' ]`
+    - vcf:
+        type: file
+        description: Input VCF file to annotate
+        pattern: "*.{vcf,vcf.gz}"
+        ontologies:
+          - edam: "http://edamontology.org/format_3016" # VCF
+  - - meta2:
+        type: map
+        description: |
+          Groovy Map containing reference information
+          e.g. `[ id:'genome' ]`
+    - reference:
+        type: file
+        description: Compressed Nirvana reference sequence file
+        pattern: "*.dat"
+  - - meta3:
+        type: map
+        description: |
+          Groovy Map containing cache information
+          e.g. `[ id:'cache' ]`
+    - cache:
+        type: directory
+        description: Nirvana cache directory
+    - cache_prefix:
+        type: string
+        description: Prefix for cache files (e.g., 'SARS-CoV-2' for files like SARS-CoV-2.transcripts.ndb)
+  - - meta4:
+        type: map
+        description: |
+          Groovy Map containing supplementary annotation information
+          e.g. `[ id:'sa' ]`
+    - supplementary_annotations:
+        type: directory
+        description: Nirvana supplementary annotation directory (optional)
+
+output:
+  json:
+    - - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. `[ id:'sample1' ]`
+      - "*.json.gz":
+          type: file
+          description: Gzip-compressed JSON file with variant annotations
+          pattern: "*.json.gz"
+          ontologies:
+            - edam: "http://edamontology.org/format_3464" # JSON
+  jsi:
+    - - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. `[ id:'sample1' ]`
+      - "*.json.gz.jsi":
+          type: file
+          description: JSON index file for the annotations
+          pattern: "*.json.gz.jsi"
+  versions_nirvana:
+    - - "${task.process}":
+          type: string
+          description: The name of the process
+      - "nirvana":
+          type: string
+          description: The name of the tool
+      - "Nirvana -v 2>&1 | awk '{print $2}' | cut -d'-' -f1":
+          type: eval
+          description: The expression to obtain the version of the tool
+
+topics:
+  versions:
+    - - ${task.process}:
+          type: string
+          description: The name of the process
+      - nirvana:
+          type: string
+          description: The name of the tool
+      - "Nirvana -v 2>&1 | awk '{print $2}' | cut -d'-' -f1":
+          type: eval
+          description: The expression to obtain the version of the tool
+authors:
+  - "@FriederikeHanssen"
+maintainers:
+  - "@FriederikeHanssen"
diff --git a/modules/nf-core/nirvana/tests/main.nf.test b/modules/nf-core/nirvana/tests/main.nf.test
new file mode 100644
index 000000000000..4c7a5e0a5531
--- /dev/null
+++ b/modules/nf-core/nirvana/tests/main.nf.test
@@ -0,0 +1,108 @@
+nextflow_process {
+
+    name "Test Process NIRVANA"
+    script "../main.nf"
+    process "NIRVANA"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "nirvana"
+    tag "untar"
+
+    setup {
+        run("UNTAR", alias: "UNTAR_CACHE") {
+            script "../../untar/main.nf"
+            process {
+                """
+                input[0] = [
+                    [ id:'Cache' ],
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/Cache.tar', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        run("UNTAR", alias: "UNTAR_SA") {
+            script "../../untar/main.nf"
+            process {
+                """
+                input[0] = [
+                    [ id:'SupplementaryAnnotation' ],
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/SupplementaryAnnotation.tar', checkIfExists: true)
+                ]
+                """
+            }
+        }
+    }
+
+    test("sarscov2 - vcf") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ],
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'reference' ],
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/SARS-CoV-2.ASM985889v3.dat', checkIfExists: true)
+                ]
+                input[2] = UNTAR_CACHE.out.untar.map { meta, dir ->
+                    [ meta, dir, 'SARS-CoV-2' ]
+                }
+                input[3] = UNTAR_SA.out.untar
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                // Remove creationTime field from JSON and snapshot the rest
+                { assert snapshot(
+                    path(process.out.json[0][1]).linesGzip.collect {
+                        it.replaceAll(/"creationTime":"[^"]*",?/, '')
+                    }
+                ).match("json_content") },
+                // Just check JSI exists
+                { assert path(process.out.jsi[0][1]).exists() },
+                { assert snapshot(process.out.versions_nirvana).match() }
+            )
+        }
+
+    }
+
+    test("sarscov2 - vcf - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test' ],
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true)
+                ]
+                input[1] = [
+                    [ id:'reference' ],
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/SARS-CoV-2.ASM985889v3.dat', checkIfExists: true)
+                ]
+                input[2] = UNTAR_CACHE.out.untar.map { meta, dir ->
+                    [ meta, dir, 'SARS-CoV-2' ]
+                }
+                input[3] = UNTAR_SA.out.untar
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+}
diff --git a/modules/nf-core/nirvana/tests/main.nf.test.snap b/modules/nf-core/nirvana/tests/main.nf.test.snap
new file mode 100644
index 000000000000..55c81f3a1850
--- /dev/null
+++ b/modules/nf-core/nirvana/tests/main.nf.test.snap
@@ -0,0 +1,97 @@
+{
+    "json_content": {
+        "content": [
+            [
+                "{\"header\":{\"annotator\":\"Nirvana 3.18.1\",\"genomeAssembly\":\"SARSCoV2\",\"schemaVersion\":6,\"dataVersion\":\"0.27.66\",\"dataSources\":[{\"name\":\"RefSeq\",\"version\":\"NC_045512.2\",\"description\":\"Severe acute respiratory syndrome coronavirus 2 (SARS-CoV2)\",\"releaseDate\":\"2020-03-20\"},{\"name\":\"alleleFrequency\",\"version\":\"SARS-COV-2_AllFreq.tsv\",\"releaseDate\":\"2020-05-08\"},{\"name\":\"proteinDomains\",\"version\":\"SARS-CoV-2_ProteinDomains.tsv\",\"releaseDate\":\"2020-05-08\"},{\"name\":\"MitochondrialHeteroplasmy\",\"version\":\"20180410\",\"description\":\"Variant read frequency percentiles for the Mitochondrial reference\",\"releaseDate\":\"2020-05-21\"}],\"samples\":[\"test\"]},\"positions\":[",
+                "{\"chromosome\":\"MT192765.1\",\"position\":197,\"refAllele\":\"G\",\"altAlleles\":[\"T\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-197-G-T\",\"chromosome\":\"MT192765.1\",\"begin\":197,\"end\":197,\"refAllele\":\"G\",\"altAllele\":\"T\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.197G>T\"}]},",
+                "{\"chromosome\":\"MT192765.1\",\"position\":4788,\"refAllele\":\"C\",\"altAlleles\":[\"T\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-4788-C-T\",\"chromosome\":\"MT192765.1\",\"begin\":4788,\"end\":4788,\"refAllele\":\"C\",\"altAllele\":\"T\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.4788C>T\"}]},",
+                "{\"chromosome\":\"MT192765.1\",\"position\":8236,\"refAllele\":\"C\",\"altAlleles\":[\"A\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-8236-C-A\",\"chromosome\":\"MT192765.1\",\"begin\":8236,\"end\":8236,\"refAllele\":\"C\",\"altAllele\":\"A\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.8236C>A\"}]},",
+                "{\"chromosome\":\"MT192765.1\",\"position\":10506,\"refAllele\":\"TTATGACTGTGTCTCTTTTTGTTACATGCACCATATG\",\"altAlleles\":[\"TTATG\"],\"quality\":18.4617,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"0/1\"}],\"variants\":[{\"vid\":\"MT192765.1-10510-NACTGTGTCTCTTTTTGTTACATGCACCATATG-N\",\"chromosome\":\"MT192765.1\",\"begin\":10511,\"end\":10542,\"refAllele\":\"ACTGTGTCTCTTTTTGTTACATGCACCATATG\",\"altAllele\":\"-\",\"variantType\":\"deletion\",\"hgvsg\":\"MT192765.1:g.10511_10542del\"}]},",
+                "{\"chromosome\":\"MT192765.1\",\"position\":11037,\"refAllele\":\"T\",\"altAlleles\":[\"C\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-11037-T-C\",\"chromosome\":\"MT192765.1\",\"begin\":11037,\"end\":11037,\"refAllele\":\"T\",\"altAllele\":\"C\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.11037T>C\"}]},",
+                "{\"chromosome\":\"MT192765.1\",\"position\":15009,\"refAllele\":\"G\",\"altAlleles\":[\"A\"],\"quality\":30.4183,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-15009-G-A\",\"chromosome\":\"MT192765.1\",\"begin\":15009,\"end\":15009,\"refAllele\":\"G\",\"altAllele\":\"A\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.15009G>A\"}]},",
+                "{\"chromosome\":\"MT192765.1\",\"position\":18807,\"refAllele\":\"T\",\"altAlleles\":[\"C\"],\"quality\":136,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-18807-T-C\",\"chromosome\":\"MT192765.1\",\"begin\":18807,\"end\":18807,\"refAllele\":\"T\",\"altAllele\":\"C\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.18807T>C\"}]},",
+                "{\"chromosome\":\"MT192765.1\",\"position\":23813,\"refAllele\":\"T\",\"altAlleles\":[\"C\"],\"quality\":4.3847,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-23813-T-C\",\"chromosome\":\"MT192765.1\",\"begin\":23813,\"end\":23813,\"refAllele\":\"T\",\"altAllele\":\"C\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.23813T>C\"}]},",
+                "{\"chromosome\":\"MT192765.1\",\"position\":24103,\"refAllele\":\"A\",\"altAlleles\":[\"G\"],\"quality\":30.4183,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-24103-A-G\",\"chromosome\":\"MT192765.1\",\"begin\":24103,\"end\":24103,\"refAllele\":\"A\",\"altAllele\":\"G\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.24103A>G\"}]}",
+                "]}"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.3",
+            "nextflow": "25.10.2"
+        },
+        "timestamp": "2026-01-12T09:27:01.830246"
+    },
+    "sarscov2 - vcf": {
+        "content": [
+            [
+                [
+                    "NIRVANA",
+                    "nirvana",
+                    "Nirvana 3.18.1"
+                ]
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.3",
+            "nextflow": "25.10.2"
+        },
+        "timestamp": "2026-01-12T09:27:01.842455"
+    },
+    "sarscov2 - vcf - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.json.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "1": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.json.gz.jsi:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "2": [
+                    [
+                        "NIRVANA",
+                        "nirvana",
+                        "Nirvana 3.18.1"
+                    ]
+                ],
+                "jsi": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.json.gz.jsi:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "json": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.json.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+                    ]
+                ],
+                "versions_nirvana": [
+                    [
+                        "NIRVANA",
+                        "nirvana",
+                        "Nirvana 3.18.1"
+                    ]
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.3",
+            "nextflow": "25.10.2"
+        },
+        "timestamp": "2026-01-12T09:27:21.144398"
+    }
+}
\ No newline at end of file