From 9c99ed05bca966ff22a67e5f282202ce4074767c Mon Sep 17 00:00:00 2001 From: Flip Mulder Date: Thu, 25 Feb 2021 14:00:58 +0100 Subject: [PATCH 1/6] New branch commit --- main.nf | 56 ++++++++++++++++++++++++++++++++++++++++++++++--- nextflow.config | 11 ++++++++++ 2 files changed, 64 insertions(+), 3 deletions(-) diff --git a/main.nf b/main.nf index 7f65404..31a169b 100644 --- a/main.nf +++ b/main.nf @@ -1,6 +1,56 @@ #! /usr/bin/env nextflow -blastdb="myBlastDatabase" -params.query="file.fasta" +println "\nI want to BLAST $params.query to $params.dbDir/$params.dbName using $params.threads CPUs and output it to $params.outdir" + +def helpMessage() { + log.info """ + Usage: + The typical command for running the pipeline is as follows: + nextflow run main.nf --query QUERY.fasta --dbDir "blastDatabaseDirectory" --dbName "blastPrefixName" + + Mandatory arguments: + --query Query fasta file of sequences you wish to BLAST + --dbDir BLAST database directory (full path required) + --dbName Prefix name of the BLAST database + + Optional arguments: + --outdir Output directory to place final BLAST output + --outfmt Output format ['6'] + --options Additional options for BLAST command [-evalue 1e-3] + --outFileName Prefix name for BLAST output [input.blastout] + --threads Number of CPUs to use during blast job [16] + --chunkSize Number of fasta records to use when splitting the query fasta file + --app BLAST program to use [blastn;blastp,tblastn,blastx] + --help This usage statement. + """ +} + +// Show help message +if (params.help) { + helpMessage() + exit 0 +} + +Channel + .fromPath(params.query) + .splitFasta(by: 1, file:true) + .set { queryFile_ch } + +process runBlast { + + input: + path(queryFile) from queryFile_ch + + output: + path(params.outFileName) into blast_output_ch + + script: + """ + blastn -num_threads $params.threads -db $params.dbDir/$params.dbName -query $queryFile -outfmt $params.outfmt $params.options -out $params.outFileName + """ + +} + +blast_output_ch + .collectFile(name: 'blast_output_combined.txt', storeDir: params.outdir) -println "I will BLAST $params.query against $blastdb" diff --git a/nextflow.config b/nextflow.config index e69de29..a2b7c7e 100644 --- a/nextflow.config +++ b/nextflow.config @@ -0,0 +1,11 @@ +params { + query = "$PWD/input.fasta" + dbDir = "$PWD/DB/" + dbName = "blastDB" + threads = 2 + outdir = "out_dir" + outFileName = "input.blastout" + options = "-evalue 1e-3" + outfmt = "'6'" + help = false +} \ No newline at end of file From 8bee8ad89d62f46131b77bce654c1d79da40e0a9 Mon Sep 17 00:00:00 2001 From: Flip Mulder Date: Thu, 25 Feb 2021 14:07:40 +0100 Subject: [PATCH 2/6] Test dir added --- out_dir/blast_output_combined.txt | 5 +++++ test/test.txt | 1 + 2 files changed, 6 insertions(+) create mode 100644 out_dir/blast_output_combined.txt create mode 100644 test/test.txt diff --git a/out_dir/blast_output_combined.txt b/out_dir/blast_output_combined.txt new file mode 100644 index 0000000..4fadc77 --- /dev/null +++ b/out_dir/blast_output_combined.txt @@ -0,0 +1,5 @@ +Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/test/test.txt b/test/test.txt new file mode 100644 index 0000000..610f2cb --- /dev/null +++ b/test/test.txt @@ -0,0 +1 @@ +Content of test.txt From 82adc338d530c39eb9d8d81c997977a1ee8791a4 Mon Sep 17 00:00:00 2001 From: Flip Mulder Date: Thu, 25 Feb 2021 14:09:32 +0100 Subject: [PATCH 3/6] Second test --- test/test2.txt | 0 1 file changed, 0 insertions(+), 0 deletions(-) create mode 100644 test/test2.txt diff --git a/test/test2.txt b/test/test2.txt new file mode 100644 index 0000000..e69de29 From 67c194135d08e9e0415cd9c2acdb13f8ad5091b0 Mon Sep 17 00:00:00 2001 From: Flip Mulder Date: Thu, 25 Feb 2021 14:13:43 +0100 Subject: [PATCH 4/6] Test all added --- .nextflow.log | 55 +++++++++ .nextflow.log.1 | 52 +++++++++ .nextflow.log.2 | 39 +++++++ .nextflow.log.3 | 40 +++++++ .nextflow.log.4 | 55 +++++++++ .nextflow.log.5 | 39 +++++++ .nextflow.log.6 | 39 +++++++ .nextflow.log.7 | 39 +++++++ .nextflow.log.8 | 32 ++++++ .nextflow.log.9 | 32 ++++++ .../db/000003.log | 0 .../db/CURRENT | 1 + .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 0 -> 50 bytes .../index.marvelous_kare | 0 .../db/000003.log | Bin 0 -> 704 bytes .../db/CURRENT | 1 + .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 0 -> 50 bytes .../index.loving_gautier | Bin 0 -> 17 bytes .../db/000003.log | Bin 0 -> 693 bytes .../db/CURRENT | 1 + .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 0 -> 50 bytes .../index.trusting_pike | Bin 0 -> 17 bytes .../db/000003.log | Bin 0 -> 703 bytes .../db/CURRENT | 1 + .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 0 -> 50 bytes .../index.fabulous_fermat | Bin 0 -> 17 bytes .../db/000003.log | 0 .../db/CURRENT | 1 + .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 0 -> 50 bytes .../index.tiny_saha | 0 .../db/000003.log | Bin 0 -> 3477 bytes .../db/CURRENT | 1 + .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 0 -> 50 bytes .../index.drunk_curran | Bin 0 -> 85 bytes .../db/000003.log | Bin 0 -> 693 bytes .../db/CURRENT | 1 + .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 0 -> 50 bytes .../index.special_plateau | Bin 0 -> 17 bytes .../db/000003.log | Bin 0 -> 3475 bytes .../db/CURRENT | 1 + .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 0 -> 50 bytes .../index.modest_noether | Bin 0 -> 85 bytes .../db/000003.log | 0 .../db/CURRENT | 1 + .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 0 -> 50 bytes .../index.pedantic_rubens | 0 .../db/000003.log | Bin 0 -> 720 bytes .../db/CURRENT | 1 + .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 0 -> 50 bytes .../index.reverent_leavitt | Bin 0 -> 17 bytes .nextflow/history | 10 ++ DB/blastDB.nhr | Bin 0 -> 408 bytes DB/blastDB.nin | Bin 0 -> 144 bytes DB/blastDB.nsq | Bin 0 -> 131 bytes input.fasta | 10 ++ out_dir/blastout/input.blastout | 1 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode | 1 + .../input.3.fasta | 1 + .../input.blastout | 1 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../f4a2c552cbdfc306b893dd7d2e74b8/.exitcode | 1 + .../input.3.fasta | 1 + .../input.blastout | 1 + .../.chunks.input.fasta | Bin 0 -> 513 bytes .../input.1.fasta | 2 + .../input.2.fasta | 2 + .../input.3.fasta | 2 + .../input.4.fasta | 2 + .../input.5.fasta | 2 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 103 +++++++++++++++++ .../.command.sh | 2 + .../04e3f135871f67b7aa32f7a492afd3/.exitcode | 1 + .../input.blastout | 5 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../a7cae8fdde157089440ff4d2e77089/.exitcode | 1 + .../input.1.fasta | 1 + .../input.blastout | 1 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../0d3867a8d3b5de4fe7c5a25071f455/.exitcode | 1 + .../input.blastout | 5 + .../input.fasta | 1 + .../.chunks.input.fasta | Bin 0 -> 513 bytes .../input.1.fasta | 2 + .../input.2.fasta | 2 + .../input.3.fasta | 2 + .../input.4.fasta | 2 + .../input.5.fasta | 2 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../a74d9f937053b223d41e8145db2861/.exitcode | 1 + .../input.5.fasta | 1 + .../input.blastout | 1 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 103 +++++++++++++++++ .../.command.sh | 2 + .../8ee16d3455b4398f550baeec536ea1/.exitcode | 1 + .../input.blastout | 5 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../c96665018e757eb6f4c0765d024062/.exitcode | 1 + .../input.5.fasta | 1 + .../input.blastout | 1 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../56e6fed73cb914f7286cd5d981894e/.exitcode | 1 + .../input.4.fasta | 1 + .../input.blastout | 1 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../3d8ec7b2376df49e34b8af5f7065e7/.exitcode | 1 + .../input.2.fasta | 1 + .../input.blastout | 1 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../95f5736be825ad1c7b0bd16ad91e73/.exitcode | 1 + .../input.blastout | 5 + .../input.fasta | 1 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../47cf90196657efefed5587143e0906/.exitcode | 1 + .../input.4.fasta | 1 + .../input.blastout | 1 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 103 +++++++++++++++++ .../.command.sh | 2 + .../591e87d704c57904782d621fa23dac/.exitcode | 1 + .../input.blastout | 5 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../0188819dd55c40e3180e3fa3a02541/.exitcode | 1 + .../input.1.fasta | 1 + .../input.blastout | 1 + .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ++++++++++++++++++ .../.command.sh | 2 + .../f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode | 1 + .../input.2.fasta | 1 + .../input.blastout | 1 + 210 files changed, 2146 insertions(+) create mode 100644 .nextflow.log create mode 100644 .nextflow.log.1 create mode 100644 .nextflow.log.2 create mode 100644 .nextflow.log.3 create mode 100644 .nextflow.log.4 create mode 100644 .nextflow.log.5 create mode 100644 .nextflow.log.6 create mode 100644 .nextflow.log.7 create mode 100644 .nextflow.log.8 create mode 100644 .nextflow.log.9 create mode 100644 .nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/000003.log create mode 100644 .nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/CURRENT create mode 100644 .nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/LOCK create mode 100644 .nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/MANIFEST-000002 create mode 100644 .nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/index.marvelous_kare create mode 100644 .nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/000003.log create mode 100644 .nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/CURRENT create mode 100644 .nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/LOCK create mode 100644 .nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/MANIFEST-000002 create mode 100644 .nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/index.loving_gautier create mode 100644 .nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/000003.log create mode 100644 .nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/CURRENT create mode 100644 .nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/LOCK create mode 100644 .nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/MANIFEST-000002 create mode 100644 .nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/index.trusting_pike create mode 100644 .nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/000003.log create mode 100644 .nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/CURRENT create mode 100644 .nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/LOCK create mode 100644 .nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/MANIFEST-000002 create mode 100644 .nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/index.fabulous_fermat create mode 100644 .nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/000003.log create mode 100644 .nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/CURRENT create mode 100644 .nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/LOCK create mode 100644 .nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/MANIFEST-000002 create mode 100644 .nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/index.tiny_saha create mode 100644 .nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/000003.log create mode 100644 .nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/CURRENT create mode 100644 .nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/LOCK create mode 100644 .nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/MANIFEST-000002 create mode 100644 .nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/index.drunk_curran create mode 100644 .nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/000003.log create mode 100644 .nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/CURRENT create mode 100644 .nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/LOCK create mode 100644 .nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/MANIFEST-000002 create mode 100644 .nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/index.special_plateau create mode 100644 .nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/000003.log create mode 100644 .nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/CURRENT create mode 100644 .nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/LOCK create mode 100644 .nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/MANIFEST-000002 create mode 100644 .nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/index.modest_noether create mode 100644 .nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/000003.log create mode 100644 .nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/CURRENT create mode 100644 .nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/LOCK create mode 100644 .nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/MANIFEST-000002 create mode 100644 .nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/index.pedantic_rubens create mode 100644 .nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/000003.log create mode 100644 .nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/CURRENT create mode 100644 .nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/LOCK create mode 100644 .nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/MANIFEST-000002 create mode 100644 .nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/index.reverent_leavitt create mode 100644 .nextflow/history create mode 100644 DB/blastDB.nhr create mode 100644 DB/blastDB.nin create mode 100644 DB/blastDB.nsq create mode 100644 input.fasta create mode 120000 out_dir/blastout/input.blastout create mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.begin create mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.err create mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.log create mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.out create mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.run create mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.sh create mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode create mode 120000 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.3.fasta create mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.blastout create mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.begin create mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.err create mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.log create mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.out create mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.run create mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.sh create mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.exitcode create mode 120000 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.3.fasta create mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.blastout create mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/.chunks.input.fasta create mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/input.1.fasta create mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta create mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta create mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta create mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta create mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.begin create mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.err create mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.log create mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.out create mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.run create mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.sh create mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.exitcode create mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/input.blastout create mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.begin create mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.err create mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.log create mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.out create mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.run create mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.sh create mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.exitcode create mode 120000 work/3f/a7cae8fdde157089440ff4d2e77089/input.1.fasta create mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/input.blastout create mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.begin create mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.err create mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.log create mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.out create mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.run create mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.sh create mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.exitcode create mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/input.blastout create mode 120000 work/71/0d3867a8d3b5de4fe7c5a25071f455/input.fasta create mode 100644 work/71/990da57db0c2c80bed5070f36a2644/.chunks.input.fasta create mode 100644 work/71/990da57db0c2c80bed5070f36a2644/input.1.fasta create mode 100644 work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta create mode 100644 work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta create mode 100644 work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta create mode 100644 work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta create mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.begin create mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.err create mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.log create mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.out create mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.run create mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.sh create mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.exitcode create mode 120000 work/7b/a74d9f937053b223d41e8145db2861/input.5.fasta create mode 100644 work/7b/a74d9f937053b223d41e8145db2861/input.blastout create mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.begin create mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.err create mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.log create mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.out create mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.run create mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.sh create mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.exitcode create mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/input.blastout create mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.begin create mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.err create mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.log create mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.out create mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.run create mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.sh create mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.exitcode create mode 120000 work/7f/c96665018e757eb6f4c0765d024062/input.5.fasta create mode 100644 work/7f/c96665018e757eb6f4c0765d024062/input.blastout create mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.begin create mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.err create mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.log create mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.out create mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.run create mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.sh create mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.exitcode create mode 120000 work/8b/56e6fed73cb914f7286cd5d981894e/input.4.fasta create mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/input.blastout create mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.begin create mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.err create mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.log create mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.out create mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.run create mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.sh create mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.exitcode create mode 120000 work/99/3d8ec7b2376df49e34b8af5f7065e7/input.2.fasta create mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/input.blastout create mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.begin create mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.err create mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.log create mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.out create mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.run create mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.sh create mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.exitcode create mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/input.blastout create mode 120000 work/ba/95f5736be825ad1c7b0bd16ad91e73/input.fasta create mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.begin create mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.err create mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.log create mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.out create mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.run create mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.sh create mode 100644 work/c4/47cf90196657efefed5587143e0906/.exitcode create mode 120000 work/c4/47cf90196657efefed5587143e0906/input.4.fasta create mode 100644 work/c4/47cf90196657efefed5587143e0906/input.blastout create mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.begin create mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.err create mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.log create mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.out create mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.run create mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.sh create mode 100644 work/c4/591e87d704c57904782d621fa23dac/.exitcode create mode 100644 work/c4/591e87d704c57904782d621fa23dac/input.blastout create mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.begin create mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.err create mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.log create mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.out create mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.run create mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.sh create mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.exitcode create mode 120000 work/c9/0188819dd55c40e3180e3fa3a02541/input.1.fasta create mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/input.blastout create mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.begin create mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.err create mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.log create mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.out create mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.run create mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.sh create mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode create mode 120000 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.2.fasta create mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.blastout diff --git a/.nextflow.log b/.nextflow.log new file mode 100644 index 0000000..d1f7b6c --- /dev/null +++ b/.nextflow.log @@ -0,0 +1,55 @@ +Feb-23 18:00:50.425 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf +Feb-23 18:00:50.655 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 +Feb-23 18:00:50.680 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [drunk_curran] - revision: d54b25fd7c +Feb-23 18:00:50.844 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 18:00:50.854 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 18:00:51.109 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` +Feb-23 18:00:52.475 [main] DEBUG nextflow.Session - Session uuid: ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8 +Feb-23 18:00:52.476 [main] DEBUG nextflow.Session - Run name: drunk_curran +Feb-23 18:00:52.478 [main] DEBUG nextflow.Session - Executor pool size: 16 +Feb-23 18:00:52.520 [main] DEBUG nextflow.cli.CmdRun - + Version: 20.10.0 build 5430 + Created: 01-11-2020 15:14 UTC (16:14 CEST) + System: Linux 4.19.128-microsoft-standard + Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 + Encoding: UTF-8 (UTF-8) + Process: 3616@LAPTOP-JNRGC094 [127.0.1.1] + CPUs: 16 - Mem: 12 GB (11.1 GB) - Swap: 4 GB (4 GB) +Feb-23 18:00:52.573 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] +Feb-23 18:00:52.574 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin +Feb-23 18:00:52.633 [main] DEBUG nextflow.Session - Observer factory: TowerFactory +Feb-23 18:00:52.637 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory +Feb-23 18:00:53.310 [main] DEBUG nextflow.Session - Session start invoked +Feb-23 18:00:54.123 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution +Feb-23 18:00:54.146 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast +Feb-23 18:00:54.274 [Actor Thread 1] DEBUG n.splitter.AbstractTextSplitter - Splitter `Fasta` collector path: nextflow.splitter.TextFileCollector$CachePath(/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.fasta, null) +Feb-23 18:00:54.341 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null +Feb-23 18:00:54.342 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' +Feb-23 18:00:54.349 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local +Feb-23 18:00:54.357 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m +Feb-23 18:00:54.509 [main] DEBUG nextflow.script.ScriptRunner - > Await termination +Feb-23 18:00:54.510 [main] DEBUG nextflow.Session - Session await +Feb-23 18:00:54.826 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 18:00:54.832 [Task submitter] INFO nextflow.Session - [1d/f4a2c5] Submitted process > runBlast (3) +Feb-23 18:00:54.866 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 18:00:54.867 [Task submitter] INFO nextflow.Session - [f7/f59d4a] Submitted process > runBlast (2) +Feb-23 18:00:54.889 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 18:00:54.891 [Task submitter] INFO nextflow.Session - [7b/a74d9f] Submitted process > runBlast (5) +Feb-23 18:00:54.910 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 18:00:54.911 [Task submitter] INFO nextflow.Session - [3f/a7cae8] Submitted process > runBlast (1) +Feb-23 18:00:54.937 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 18:00:54.939 [Task submitter] INFO nextflow.Session - [c4/47cf90] Submitted process > runBlast (4) +Feb-23 18:00:54.954 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 2; name: runBlast (3); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/1d/f4a2c552cbdfc306b893dd7d2e74b8] +Feb-23 18:00:54.976 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 4; name: runBlast (2); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78] +Feb-23 18:00:55.002 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast (5); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/7b/a74d9f937053b223d41e8145db2861] +Feb-23 18:00:55.009 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 3; name: runBlast (1); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/3f/a7cae8fdde157089440ff4d2e77089] +Feb-23 18:00:55.036 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 5; name: runBlast (4); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/47cf90196657efefed5587143e0906] +Feb-23 18:00:55.042 [main] DEBUG nextflow.Session - Session await > all process finished +Feb-23 18:00:55.101 [Actor Thread 1] DEBUG nextflow.sort.BigSort - Sort completed -- entries: 5; slices: 1; internal sort time: 0.05 s; external sort time: 0.001 s; total time: 0.051 s +Feb-23 18:00:55.135 [Actor Thread 1] DEBUG nextflow.file.FileCollector - Saved collect-files list to: /tmp/205544ad8fa70bcb42fa66aee246028d.collect-file +Feb-23 18:00:55.136 [main] DEBUG nextflow.Session - Session await > all barriers passed +Feb-23 18:00:55.144 [Actor Thread 1] DEBUG nextflow.file.FileCollector - Deleting file collector temp dir: /tmp/nxf-13992828883881010697 +Feb-23 18:00:55.152 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=5; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=242ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=3; peakCpus=3; peakMemory=0; ] +Feb-23 18:00:55.248 [main] DEBUG nextflow.CacheDB - Closing CacheDB done +Feb-23 18:00:55.252 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown +Feb-23 18:00:55.283 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.1 b/.nextflow.log.1 new file mode 100644 index 0000000..e9ac2d5 --- /dev/null +++ b/.nextflow.log.1 @@ -0,0 +1,52 @@ +Feb-23 17:58:46.370 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf +Feb-23 17:58:46.587 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 +Feb-23 17:58:46.606 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [modest_noether] - revision: 0a507e6896 +Feb-23 17:58:46.645 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 17:58:46.646 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 17:58:46.680 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` +Feb-23 17:58:47.536 [main] DEBUG nextflow.Session - Session uuid: e28879fe-8327-4035-8a19-947fb5ce86d4 +Feb-23 17:58:47.536 [main] DEBUG nextflow.Session - Run name: modest_noether +Feb-23 17:58:47.538 [main] DEBUG nextflow.Session - Executor pool size: 16 +Feb-23 17:58:47.576 [main] DEBUG nextflow.cli.CmdRun - + Version: 20.10.0 build 5430 + Created: 01-11-2020 15:14 UTC (16:14 CEST) + System: Linux 4.19.128-microsoft-standard + Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 + Encoding: UTF-8 (UTF-8) + Process: 3403@LAPTOP-JNRGC094 [127.0.1.1] + CPUs: 16 - Mem: 12 GB (11.1 GB) - Swap: 4 GB (4 GB) +Feb-23 17:58:47.634 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] +Feb-23 17:58:47.636 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin +Feb-23 17:58:47.698 [main] DEBUG nextflow.Session - Observer factory: TowerFactory +Feb-23 17:58:47.701 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory +Feb-23 17:58:47.932 [main] DEBUG nextflow.Session - Session start invoked +Feb-23 17:58:48.351 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution +Feb-23 17:58:48.370 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast +Feb-23 17:58:48.508 [Actor Thread 1] DEBUG n.splitter.AbstractTextSplitter - Splitter `Fasta` collector path: nextflow.splitter.TextFileCollector$CachePath(/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.fasta, null) +Feb-23 17:58:48.580 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null +Feb-23 17:58:48.581 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' +Feb-23 17:58:48.590 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local +Feb-23 17:58:48.613 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m +Feb-23 17:58:48.731 [main] DEBUG nextflow.script.ScriptRunner - > Await termination +Feb-23 17:58:48.732 [main] DEBUG nextflow.Session - Session await +Feb-23 17:58:49.113 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 17:58:49.120 [Task submitter] INFO nextflow.Session - [11/6632f0] Submitted process > runBlast (3) +Feb-23 17:58:49.150 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 17:58:49.151 [Task submitter] INFO nextflow.Session - [99/3d8ec7] Submitted process > runBlast (2) +Feb-23 17:58:49.175 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 17:58:49.176 [Task submitter] INFO nextflow.Session - [8b/56e6fe] Submitted process > runBlast (4) +Feb-23 17:58:49.208 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 17:58:49.210 [Task submitter] INFO nextflow.Session - [c9/018881] Submitted process > runBlast (1) +Feb-23 17:58:49.241 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 2; name: runBlast (3); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc] +Feb-23 17:58:49.245 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 17:58:49.248 [Task submitter] INFO nextflow.Session - [7f/c96665] Submitted process > runBlast (5) +Feb-23 17:58:49.297 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast (2); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/99/3d8ec7b2376df49e34b8af5f7065e7] +Feb-23 17:58:49.327 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 5; name: runBlast (4); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/8b/56e6fed73cb914f7286cd5d981894e] +Feb-23 17:58:49.360 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 4; name: runBlast (1); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/c9/0188819dd55c40e3180e3fa3a02541] +Feb-23 17:58:49.382 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 3; name: runBlast (5); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/c96665018e757eb6f4c0765d024062] +Feb-23 17:58:49.400 [main] DEBUG nextflow.Session - Session await > all process finished +Feb-23 17:58:49.401 [main] DEBUG nextflow.Session - Session await > all barriers passed +Feb-23 17:58:49.407 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=5; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=26ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] +Feb-23 17:58:49.633 [main] DEBUG nextflow.CacheDB - Closing CacheDB done +Feb-23 17:58:49.637 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown +Feb-23 17:58:49.673 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.2 b/.nextflow.log.2 new file mode 100644 index 0000000..894e827 --- /dev/null +++ b/.nextflow.log.2 @@ -0,0 +1,39 @@ +Feb-23 17:58:06.133 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf +Feb-23 17:58:06.363 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 +Feb-23 17:58:06.387 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [trusting_pike] - revision: 7228a16b59 +Feb-23 17:58:06.426 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 17:58:06.428 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 17:58:06.461 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` +Feb-23 17:58:07.308 [main] DEBUG nextflow.Session - Session uuid: 7d3f89a6-bccf-443b-bd4a-3a96c7f57638 +Feb-23 17:58:07.308 [main] DEBUG nextflow.Session - Run name: trusting_pike +Feb-23 17:58:07.309 [main] DEBUG nextflow.Session - Executor pool size: 16 +Feb-23 17:58:07.352 [main] DEBUG nextflow.cli.CmdRun - + Version: 20.10.0 build 5430 + Created: 01-11-2020 15:14 UTC (16:14 CEST) + System: Linux 4.19.128-microsoft-standard + Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 + Encoding: UTF-8 (UTF-8) + Process: 3288@LAPTOP-JNRGC094 [127.0.1.1] + CPUs: 16 - Mem: 12 GB (11.2 GB) - Swap: 4 GB (4 GB) +Feb-23 17:58:07.404 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] +Feb-23 17:58:07.405 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin +Feb-23 17:58:07.445 [main] DEBUG nextflow.Session - Observer factory: TowerFactory +Feb-23 17:58:07.450 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory +Feb-23 17:58:07.690 [main] DEBUG nextflow.Session - Session start invoked +Feb-23 17:58:08.132 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution +Feb-23 17:58:08.150 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast +Feb-23 17:58:08.310 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null +Feb-23 17:58:08.311 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' +Feb-23 17:58:08.319 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local +Feb-23 17:58:08.325 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m +Feb-23 17:58:08.437 [main] DEBUG nextflow.script.ScriptRunner - > Await termination +Feb-23 17:58:08.438 [main] DEBUG nextflow.Session - Session await +Feb-23 17:58:08.790 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 17:58:08.801 [Task submitter] INFO nextflow.Session - [ba/95f573] Submitted process > runBlast (1) +Feb-23 17:58:08.904 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast (1); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/ba/95f5736be825ad1c7b0bd16ad91e73] +Feb-23 17:58:08.940 [main] DEBUG nextflow.Session - Session await > all process finished +Feb-23 17:58:08.943 [main] DEBUG nextflow.Session - Session await > all barriers passed +Feb-23 17:58:08.950 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=1; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=60ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] +Feb-23 17:58:09.184 [main] DEBUG nextflow.CacheDB - Closing CacheDB done +Feb-23 17:58:09.189 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown +Feb-23 17:58:09.221 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.3 b/.nextflow.log.3 new file mode 100644 index 0000000..528c383 --- /dev/null +++ b/.nextflow.log.3 @@ -0,0 +1,40 @@ +Feb-23 17:57:41.097 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf +Feb-23 17:57:41.284 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 +Feb-23 17:57:41.305 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [special_plateau] - revision: 3dd7a0c300 +Feb-23 17:57:41.338 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 17:57:41.340 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 17:57:41.373 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` +Feb-23 17:57:42.234 [main] DEBUG nextflow.Session - Session uuid: e25eb517-482a-4dc2-8c08-e6575b46df44 +Feb-23 17:57:42.235 [main] DEBUG nextflow.Session - Run name: special_plateau +Feb-23 17:57:42.236 [main] DEBUG nextflow.Session - Executor pool size: 16 +Feb-23 17:57:42.290 [main] DEBUG nextflow.cli.CmdRun - + Version: 20.10.0 build 5430 + Created: 01-11-2020 15:14 UTC (16:14 CEST) + System: Linux 4.19.128-microsoft-standard + Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 + Encoding: UTF-8 (UTF-8) + Process: 3171@LAPTOP-JNRGC094 [127.0.1.1] + CPUs: 16 - Mem: 12 GB (11.1 GB) - Swap: 4 GB (4 GB) +Feb-23 17:57:42.357 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] +Feb-23 17:57:42.358 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin +Feb-23 17:57:42.429 [main] DEBUG nextflow.Session - Observer factory: TowerFactory +Feb-23 17:57:42.432 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory +Feb-23 17:57:42.646 [main] DEBUG nextflow.Session - Session start invoked +Feb-23 17:57:43.062 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution +Feb-23 17:57:43.079 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast +Feb-23 17:57:43.154 [main] WARN nextflow.extension.IntoOp - The `into` operator should be used to connect two or more target channels -- consider to replace it with `.set { queryFile_ch }` +Feb-23 17:57:43.272 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null +Feb-23 17:57:43.273 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' +Feb-23 17:57:43.281 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local +Feb-23 17:57:43.288 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m +Feb-23 17:57:43.394 [main] DEBUG nextflow.script.ScriptRunner - > Await termination +Feb-23 17:57:43.395 [main] DEBUG nextflow.Session - Session await +Feb-23 17:57:43.736 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 17:57:43.744 [Task submitter] INFO nextflow.Session - [71/0d3867] Submitted process > runBlast (1) +Feb-23 17:57:43.858 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast (1); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/71/0d3867a8d3b5de4fe7c5a25071f455] +Feb-23 17:57:43.892 [main] DEBUG nextflow.Session - Session await > all process finished +Feb-23 17:57:43.895 [main] DEBUG nextflow.Session - Session await > all barriers passed +Feb-23 17:57:43.903 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=1; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=52ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] +Feb-23 17:57:44.134 [main] DEBUG nextflow.CacheDB - Closing CacheDB done +Feb-23 17:57:44.137 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown +Feb-23 17:57:44.169 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.4 b/.nextflow.log.4 new file mode 100644 index 0000000..76a9f88 --- /dev/null +++ b/.nextflow.log.4 @@ -0,0 +1,55 @@ +Feb-23 17:57:06.765 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf +Feb-23 17:57:06.974 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 +Feb-23 17:57:06.994 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [pedantic_rubens] - revision: 3bfdc02ef4 +Feb-23 17:57:07.025 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 17:57:07.027 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 17:57:07.062 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` +Feb-23 17:57:07.870 [main] DEBUG nextflow.Session - Session uuid: e38dcb45-706f-4949-9d2c-76fafacf54dd +Feb-23 17:57:07.870 [main] DEBUG nextflow.Session - Run name: pedantic_rubens +Feb-23 17:57:07.871 [main] DEBUG nextflow.Session - Executor pool size: 16 +Feb-23 17:57:07.908 [main] DEBUG nextflow.cli.CmdRun - + Version: 20.10.0 build 5430 + Created: 01-11-2020 15:14 UTC (16:14 CEST) + System: Linux 4.19.128-microsoft-standard + Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 + Encoding: UTF-8 (UTF-8) + Process: 3073@LAPTOP-JNRGC094 [127.0.1.1] + CPUs: 16 - Mem: 12 GB (11.2 GB) - Swap: 4 GB (4 GB) +Feb-23 17:57:07.971 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] +Feb-23 17:57:07.972 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin +Feb-23 17:57:08.016 [main] DEBUG nextflow.Session - Observer factory: TowerFactory +Feb-23 17:57:08.020 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory +Feb-23 17:57:08.252 [main] DEBUG nextflow.Session - Session start invoked +Feb-23 17:57:08.682 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution +Feb-23 17:57:08.702 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast +Feb-23 17:57:08.785 [main] WARN nextflow.extension.IntoOp - The `into` operator should be used to connect two or more target channels -- consider to replace it with `.set { queryFile_ch }` +Feb-23 17:57:08.894 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null +Feb-23 17:57:08.894 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' +Feb-23 17:57:08.901 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local +Feb-23 17:57:08.907 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m +Feb-23 17:57:08.999 [main] DEBUG nextflow.script.ScriptRunner - > Await termination +Feb-23 17:57:09.000 [main] DEBUG nextflow.Session - Session await +Feb-23 17:57:09.111 [Actor Thread 3] ERROR nextflow.processor.TaskProcessor - Error executing process > 'runBlast (1)' + +Caused by: + Unknown variable 'pqueryFile' -- Make sure it is not misspelt and defined somewhere in the script before using it + +Source block: + """ + blastn -num_threads $params.threads -db $params.dbDir/$params.dbName -query $pqueryFile -outfmt $params.outfmt $params.options -out $params.outFileName + """ + +Tip: when you have fixed the problem you can continue the execution adding the option `-resume` to the run command line +Feb-23 17:57:09.119 [Actor Thread 3] DEBUG nextflow.Session - Session aborted -- Cause: Process `null` script contains error(s) +Feb-23 17:57:09.142 [Actor Thread 3] DEBUG nextflow.Session - The following nodes are still active: +[process] runBlast + status=ACTIVE + port 0: (queue) closed; channel: queryFile + port 1: (cntrl) - ; channel: $ + +Feb-23 17:57:09.145 [main] DEBUG nextflow.Session - Session await > all process finished +Feb-23 17:57:09.146 [main] DEBUG nextflow.Session - Session await > all barriers passed +Feb-23 17:57:09.154 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=0; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=0ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=0; peakCpus=0; peakMemory=0; ] +Feb-23 17:57:09.351 [main] DEBUG nextflow.CacheDB - Closing CacheDB done +Feb-23 17:57:09.355 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown +Feb-23 17:57:09.395 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.5 b/.nextflow.log.5 new file mode 100644 index 0000000..a40eb03 --- /dev/null +++ b/.nextflow.log.5 @@ -0,0 +1,39 @@ +Feb-23 17:50:36.273 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf +Feb-23 17:50:36.476 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 +Feb-23 17:50:36.497 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [reverent_leavitt] - revision: 8c0baa1798 +Feb-23 17:50:36.539 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 17:50:36.541 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 17:50:36.577 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` +Feb-23 17:50:37.466 [main] DEBUG nextflow.Session - Session uuid: ffccacf1-a0d4-4d67-a60d-6d78f86640e8 +Feb-23 17:50:37.466 [main] DEBUG nextflow.Session - Run name: reverent_leavitt +Feb-23 17:50:37.467 [main] DEBUG nextflow.Session - Executor pool size: 16 +Feb-23 17:50:37.514 [main] DEBUG nextflow.cli.CmdRun - + Version: 20.10.0 build 5430 + Created: 01-11-2020 15:14 UTC (16:14 CEST) + System: Linux 4.19.128-microsoft-standard + Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 + Encoding: UTF-8 (UTF-8) + Process: 2952@LAPTOP-JNRGC094 [127.0.1.1] + CPUs: 16 - Mem: 12 GB (11.2 GB) - Swap: 4 GB (4 GB) +Feb-23 17:50:37.576 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] +Feb-23 17:50:37.578 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin +Feb-23 17:50:37.640 [main] DEBUG nextflow.Session - Observer factory: TowerFactory +Feb-23 17:50:37.644 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory +Feb-23 17:50:37.893 [main] DEBUG nextflow.Session - Session start invoked +Feb-23 17:50:38.274 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution +Feb-23 17:50:38.295 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast +Feb-23 17:50:38.394 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null +Feb-23 17:50:38.395 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' +Feb-23 17:50:38.404 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local +Feb-23 17:50:38.417 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m +Feb-23 17:50:38.577 [main] DEBUG nextflow.script.ScriptRunner - > Await termination +Feb-23 17:50:38.578 [main] DEBUG nextflow.Session - Session await +Feb-23 17:50:38.959 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 17:50:38.966 [Task submitter] INFO nextflow.Session - [c4/591e87] Submitted process > runBlast +Feb-23 17:50:39.239 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast; status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/591e87d704c57904782d621fa23dac] +Feb-23 17:50:39.275 [main] DEBUG nextflow.Session - Session await > all process finished +Feb-23 17:50:39.278 [main] DEBUG nextflow.Session - Session await > all barriers passed +Feb-23 17:50:39.286 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=1; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=191ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] +Feb-23 17:50:39.397 [main] DEBUG nextflow.CacheDB - Closing CacheDB done +Feb-23 17:50:39.403 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown +Feb-23 17:50:39.433 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.6 b/.nextflow.log.6 new file mode 100644 index 0000000..7686adb --- /dev/null +++ b/.nextflow.log.6 @@ -0,0 +1,39 @@ +Feb-23 10:59:48.511 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf +Feb-23 10:59:48.682 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 +Feb-23 10:59:48.701 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [loving_gautier] - revision: 90b303acac +Feb-23 10:59:48.741 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 10:59:48.743 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 10:59:48.780 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` +Feb-23 10:59:49.647 [main] DEBUG nextflow.Session - Session uuid: 6cc9b687-9f88-4abd-b1c2-34d13dedccaa +Feb-23 10:59:49.648 [main] DEBUG nextflow.Session - Run name: loving_gautier +Feb-23 10:59:49.651 [main] DEBUG nextflow.Session - Executor pool size: 16 +Feb-23 10:59:49.693 [main] DEBUG nextflow.cli.CmdRun - + Version: 20.10.0 build 5430 + Created: 01-11-2020 15:14 UTC (16:14 CEST) + System: Linux 4.19.128-microsoft-standard + Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 + Encoding: UTF-8 (UTF-8) + Process: 2837@LAPTOP-JNRGC094 [127.0.1.1] + CPUs: 16 - Mem: 12 GB (11.1 GB) - Swap: 4 GB (4 GB) +Feb-23 10:59:49.749 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] +Feb-23 10:59:49.750 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin +Feb-23 10:59:49.795 [main] DEBUG nextflow.Session - Observer factory: TowerFactory +Feb-23 10:59:49.799 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory +Feb-23 10:59:50.014 [main] DEBUG nextflow.Session - Session start invoked +Feb-23 10:59:50.310 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution +Feb-23 10:59:50.328 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast +Feb-23 10:59:50.389 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null +Feb-23 10:59:50.390 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' +Feb-23 10:59:50.399 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local +Feb-23 10:59:50.408 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m +Feb-23 10:59:50.601 [main] DEBUG nextflow.script.ScriptRunner - > Await termination +Feb-23 10:59:50.602 [main] DEBUG nextflow.Session - Session await +Feb-23 10:59:50.899 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 10:59:50.907 [Task submitter] INFO nextflow.Session - [26/04e3f1] Submitted process > runBlast +Feb-23 10:59:50.998 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast; status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/26/04e3f135871f67b7aa32f7a492afd3] +Feb-23 10:59:51.020 [main] DEBUG nextflow.Session - Session await > all process finished +Feb-23 10:59:51.022 [main] DEBUG nextflow.Session - Session await > all barriers passed +Feb-23 10:59:51.031 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=1; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=60ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] +Feb-23 10:59:51.155 [main] DEBUG nextflow.CacheDB - Closing CacheDB done +Feb-23 10:59:51.159 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown +Feb-23 10:59:51.186 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.7 b/.nextflow.log.7 new file mode 100644 index 0000000..fcf8a85 --- /dev/null +++ b/.nextflow.log.7 @@ -0,0 +1,39 @@ +Feb-23 10:58:01.567 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf +Feb-23 10:58:01.727 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 +Feb-23 10:58:01.749 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [fabulous_fermat] - revision: 6593265ff7 +Feb-23 10:58:01.784 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 10:58:01.786 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 10:58:01.821 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` +Feb-23 10:58:02.660 [main] DEBUG nextflow.Session - Session uuid: 82425c5e-2c2c-408c-b892-c2f085aed751 +Feb-23 10:58:02.661 [main] DEBUG nextflow.Session - Run name: fabulous_fermat +Feb-23 10:58:02.663 [main] DEBUG nextflow.Session - Executor pool size: 16 +Feb-23 10:58:02.707 [main] DEBUG nextflow.cli.CmdRun - + Version: 20.10.0 build 5430 + Created: 01-11-2020 15:14 UTC (16:14 CEST) + System: Linux 4.19.128-microsoft-standard + Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 + Encoding: UTF-8 (UTF-8) + Process: 2718@LAPTOP-JNRGC094 [127.0.1.1] + CPUs: 16 - Mem: 12 GB (11.1 GB) - Swap: 4 GB (4 GB) +Feb-23 10:58:02.755 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] +Feb-23 10:58:02.756 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin +Feb-23 10:58:02.802 [main] DEBUG nextflow.Session - Observer factory: TowerFactory +Feb-23 10:58:02.807 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory +Feb-23 10:58:03.046 [main] DEBUG nextflow.Session - Session start invoked +Feb-23 10:58:03.321 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution +Feb-23 10:58:03.339 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast +Feb-23 10:58:03.389 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null +Feb-23 10:58:03.390 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' +Feb-23 10:58:03.397 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local +Feb-23 10:58:03.405 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m +Feb-23 10:58:03.553 [main] DEBUG nextflow.script.ScriptRunner - > Await termination +Feb-23 10:58:03.554 [main] DEBUG nextflow.Session - Session await +Feb-23 10:58:03.766 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run +Feb-23 10:58:03.774 [Task submitter] INFO nextflow.Session - [7f/8ee16d] Submitted process > runBlast +Feb-23 10:58:03.869 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast; status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/8ee16d3455b4398f550baeec536ea1] +Feb-23 10:58:03.888 [main] DEBUG nextflow.Session - Session await > all process finished +Feb-23 10:58:03.891 [main] DEBUG nextflow.Session - Session await > all barriers passed +Feb-23 10:58:03.901 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=1; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=36ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] +Feb-23 10:58:04.129 [main] DEBUG nextflow.CacheDB - Closing CacheDB done +Feb-23 10:58:04.132 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown +Feb-23 10:58:04.162 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.8 b/.nextflow.log.8 new file mode 100644 index 0000000..331291a --- /dev/null +++ b/.nextflow.log.8 @@ -0,0 +1,32 @@ +Feb-23 10:55:04.031 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf +Feb-23 10:55:04.251 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 +Feb-23 10:55:04.278 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [marvelous_kare] - revision: 17ee5c59e3 +Feb-23 10:55:04.316 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 10:55:04.319 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 10:55:04.353 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` +Feb-23 10:55:05.241 [main] DEBUG nextflow.Session - Session uuid: 44a9c761-7c53-4e93-985b-3efc6907178e +Feb-23 10:55:05.241 [main] DEBUG nextflow.Session - Run name: marvelous_kare +Feb-23 10:55:05.243 [main] DEBUG nextflow.Session - Executor pool size: 16 +Feb-23 10:55:05.286 [main] DEBUG nextflow.cli.CmdRun - + Version: 20.10.0 build 5430 + Created: 01-11-2020 15:14 UTC (16:14 CEST) + System: Linux 4.19.128-microsoft-standard + Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 + Encoding: UTF-8 (UTF-8) + Process: 2313@LAPTOP-JNRGC094 [127.0.1.1] + CPUs: 16 - Mem: 12 GB (11.2 GB) - Swap: 4 GB (4 GB) +Feb-23 10:55:05.339 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] +Feb-23 10:55:05.340 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin +Feb-23 10:55:05.396 [main] DEBUG nextflow.Session - Observer factory: TowerFactory +Feb-23 10:55:05.399 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory +Feb-23 10:55:05.592 [main] DEBUG nextflow.Session - Session start invoked +Feb-23 10:55:05.744 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution +Feb-23 10:55:05.763 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: +Feb-23 10:55:05.768 [main] DEBUG nextflow.script.ScriptRunner - > Await termination +Feb-23 10:55:05.769 [main] DEBUG nextflow.Session - Session await +Feb-23 10:55:05.770 [main] DEBUG nextflow.Session - Session await > all process finished +Feb-23 10:55:05.770 [main] DEBUG nextflow.Session - Session await > all barriers passed +Feb-23 10:55:05.790 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=0; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=0ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=0; peakCpus=0; peakMemory=0; ] +Feb-23 10:55:05.839 [main] DEBUG nextflow.CacheDB - Closing CacheDB done +Feb-23 10:55:05.842 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown +Feb-23 10:55:05.877 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.9 b/.nextflow.log.9 new file mode 100644 index 0000000..7443694 --- /dev/null +++ b/.nextflow.log.9 @@ -0,0 +1,32 @@ +Feb-23 10:34:39.942 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf +Feb-23 10:34:40.130 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 +Feb-23 10:34:40.162 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [tiny_saha] - revision: 0e6d4aa3ec +Feb-23 10:34:40.211 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 10:34:40.213 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config +Feb-23 10:34:40.254 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` +Feb-23 10:34:41.154 [main] DEBUG nextflow.Session - Session uuid: a33372da-190e-4d40-a449-71e610806fc2 +Feb-23 10:34:41.154 [main] DEBUG nextflow.Session - Run name: tiny_saha +Feb-23 10:34:41.156 [main] DEBUG nextflow.Session - Executor pool size: 16 +Feb-23 10:34:41.205 [main] DEBUG nextflow.cli.CmdRun - + Version: 20.10.0 build 5430 + Created: 01-11-2020 15:14 UTC (16:14 CEST) + System: Linux 4.19.128-microsoft-standard + Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 + Encoding: UTF-8 (UTF-8) + Process: 2092@LAPTOP-JNRGC094 [127.0.1.1] + CPUs: 16 - Mem: 12 GB (11.2 GB) - Swap: 4 GB (4 GB) +Feb-23 10:34:41.311 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] +Feb-23 10:34:41.312 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin +Feb-23 10:34:41.382 [main] DEBUG nextflow.Session - Observer factory: TowerFactory +Feb-23 10:34:41.388 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory +Feb-23 10:34:41.737 [main] DEBUG nextflow.Session - Session start invoked +Feb-23 10:34:42.125 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution +Feb-23 10:34:42.157 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: +Feb-23 10:34:42.166 [main] DEBUG nextflow.script.ScriptRunner - > Await termination +Feb-23 10:34:42.167 [main] DEBUG nextflow.Session - Session await +Feb-23 10:34:42.168 [main] DEBUG nextflow.Session - Session await > all process finished +Feb-23 10:34:42.168 [main] DEBUG nextflow.Session - Session await > all barriers passed +Feb-23 10:34:42.198 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=0; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=0ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=0; peakCpus=0; peakMemory=0; ] +Feb-23 10:34:42.419 [main] DEBUG nextflow.CacheDB - Closing CacheDB done +Feb-23 10:34:42.427 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown +Feb-23 10:34:42.524 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/000003.log b/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/000003.log new file mode 100644 index 0000000..e69de29 diff --git a/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/CURRENT b/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/CURRENT new file mode 100644 index 0000000..1a84852 --- /dev/null +++ b/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/CURRENT @@ -0,0 +1 @@ +MANIFEST-000002 diff --git a/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/LOCK b/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/LOCK new file mode 100644 index 0000000..e69de29 diff --git a/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/MANIFEST-000002 b/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/MANIFEST-000002 new file mode 100644 index 0000000000000000000000000000000000000000..bbbc585686bcbcc33686059c69d80b7b4e1291cd GIT binary patch literal 50 zcmWIhx#Ncn10$nUPHI_dPD+xVQ)NkNd1i5{bAE0?Vo_pAe$kRS-TOEg7@3$k8JJmE F7y#sj5K{mE literal 0 HcmV?d00001 diff --git a/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/index.marvelous_kare b/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/index.marvelous_kare new file mode 100644 index 0000000..e69de29 diff --git a/.nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/000003.log b/.nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/000003.log new file mode 100644 index 0000000000000000000000000000000000000000..404fe11ca871fd7670ab416ca2fb08f225c1332b GIT binary patch literal 704 zcma)4F>ezw6wW)B;W{z1a06mXj$YaXM$$$CDHRNr7!Zn_J0CGQ+lT$!roVu_8w(RH zhy^hrR>aE0PoRMcBm~W=kPSOg1Y;J~jVG5M zzI~Paetz)!)6)x3dqj6>!y+#lH?^kwJ#H!>0QcX+Y~_En$K{A+x2PFz)1PpO08%sR z^J4(X#+VmsuTg51GGml(>^SW9F$4q*QnXV7n|HSF_PRUW4+MtPoDfJ_@wIi<%-;}@ zR7?nHD?0@>6#+KpRZw$WI}p4I&kheKvj_7~x(bhu7TzM+l&pFsU)^h=GFwa__*c-T zDhie&SJGVRiV~N_rAi{@lASshMP#C^0xvbyymaZm1*=gsa8gi4QC(Wm$Dw94Gf@)N zvq2OKiE$R+Q+gCHYwsJhc^=CgEh^1v5pQ+kcphY{6V)GEruWZDHw#5E}CL`;wss5dNO`W;3J$*p(n)4Z&+(?TyL-Ct@fZzX*0>&bp1v` z^Q=k0iMJD%AT90G_en6J^vqpk+d9Cau5B002kG2!j9s literal 0 HcmV?d00001 diff --git a/.nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/000003.log b/.nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/000003.log new file mode 100644 index 0000000000000000000000000000000000000000..6bade72b6d10541d8824712858c4982270b9e95d GIT binary patch literal 693 zcma)4J!}&(7|nMF!@BJd$am*c+??&Jf6`Pez`)pz z5s8%n7B(h?5E}zxs#qHlfmEUPKmoiu_G54Ju(zxO>q`^)pKy;mMUZ9d!z=iWU1 zsfN?bFE2be`)PCUqS`$TwM{(2b)#ufzab^w=}}dI4{+}t9Gv-Yzp z_d#Pd?9+V!PR2Sf#CE-uA|*-*S>LeOt$px(P#SA<J z(e>O4V-yObbEeT!YYBy9gbPDZOv1(tI5|0^+jG{=%pKP0)LP!QjWc@a!$E5rJ2|UX=#pJAdD~}kL^ZA)pxsS${bAiFE>jm wWFNbD4{VtVRu)80f+vsX@01yd9Tt4BU(3cFFwoW z?)&wZyH}2WJXCKFFGKAq+hdVKkw(nJo$M15pMw&vgSS%J9#t!|C~xc_>qcUtTY~MY0)Lsg!*6ucc01K84_4 zK^r>Hd4fVKd%Y_QTo#vTg-j@Z=2;Ap%c2Y_sfiJVPya1gp>*J-prW*{ob2P!aF$wn zo7U3-jitgkjUQ<^MMffXTM{zBSlwpxQ`V|^`awQda<=Si#4 z=4_RK7w@J%K~lI`)h5ZMHs}5#752L~C}ah5^{d*A(WcL;rvLPAqGgeDoQ6kl7QdD{ e!zwI%=ZDNUHLuv=Ry6}C_PC#?@bqRa2>t?lVD{$# literal 0 HcmV?d00001 diff --git a/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/CURRENT b/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/CURRENT new file mode 100644 index 0000000..1a84852 --- /dev/null +++ b/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/CURRENT @@ -0,0 +1 @@ +MANIFEST-000002 diff --git a/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/LOCK b/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/LOCK new file mode 100644 index 0000000..e69de29 diff --git a/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/MANIFEST-000002 b/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/MANIFEST-000002 new file mode 100644 index 0000000000000000000000000000000000000000..bbbc585686bcbcc33686059c69d80b7b4e1291cd GIT binary patch literal 50 zcmWIhx#Ncn10$nUPHI_dPD+xVQ)NkNd1i5{bAE0?Vo_pAe$kRS-TOEg7@3$k8JJmE F7y#sj5K{mE literal 0 HcmV?d00001 diff --git a/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/index.fabulous_fermat b/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/index.fabulous_fermat new file mode 100644 index 0000000000000000000000000000000000000000..a4ea29821b6cfa29560dcc1b366831d0348395ed GIT binary patch literal 17 Ycmb>Ldzfnyy2Y|TlzZKq;Jk$l07;(*y#N3J literal 0 HcmV?d00001 diff --git a/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/000003.log b/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/000003.log new file mode 100644 index 0000000..e69de29 diff --git a/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/CURRENT b/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/CURRENT new file mode 100644 index 0000000..1a84852 --- /dev/null +++ b/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/CURRENT @@ -0,0 +1 @@ +MANIFEST-000002 diff --git a/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/LOCK b/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/LOCK new file mode 100644 index 0000000..e69de29 diff --git a/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/MANIFEST-000002 b/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/MANIFEST-000002 new file mode 100644 index 0000000000000000000000000000000000000000..bbbc585686bcbcc33686059c69d80b7b4e1291cd GIT binary patch literal 50 zcmWIhx#Ncn10$nUPHI_dPD+xVQ)NkNd1i5{bAE0?Vo_pAe$kRS-TOEg7@3$k8JJmE F7y#sj5K{mE literal 0 HcmV?d00001 diff --git a/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/index.tiny_saha b/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/index.tiny_saha new file mode 100644 index 0000000..e69de29 diff --git a/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/000003.log b/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/000003.log new file mode 100644 index 0000000000000000000000000000000000000000..51d0e0bdbb24e1a598b5da448831fe5c8961b8ab GIT binary patch literal 3477 zcmdtkO=uKX902gVnIv?*vX+O{_~$7|Jk7n=J*K?fTr>%J%U$WFAiP!=*Ju9TSxX^`#eWS_O*bfZLlBa66(0Q z_o4{y=yKvB-~re&27Yg@o$Ye`K8)Unac?(#0AA$*g>hexGXa2)2Pkoa?YS@tY#hfy zl-tDSK9~T_Jcucz$t(}neb~LRt8-K5I1hSZJk0|ci9~~neToM@^d@-_C4RdLV=Ams zzvTfQaEe?LTc22-Q_S2PI`R0?)>62rm^pW(JSuO_-rTyt zb+JvIz>imTdLgaes2%teIzE2LRzXU!7Zy2=?PEty$iiLamI;EDrsWGl)=#`1+8ber zVnGqI$Pz@)ry>$J2T`9`twT>t6GB9v(1Zq&16{GBT@*_}I@*QoX9Pb)o3766Wdom`@5c;MX7KGMj%)j& zMPhEbI=6rQacIM~-(I^kJoDw5)4O&KEVSE~O3?n>Eipu*7m#+V(XGt%zQrB(|EETr$VzI4O-y{fO zSvMrJplK2zTKX>`9nBNl(P!C?)v{e%%l2N%cIqrS!q~Rdu^nIk^WaLd`TqU8pX^@# zPNsFC*)E%dt*wcgVUxmeBU`PJ?di(frrd46S}JU{#bR5nz9bj&dELN-eUYx4hODVr VDoFWxV*B@;Y(K4Kd$5hM{RbO)zD)oC literal 0 HcmV?d00001 diff --git a/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/CURRENT b/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/CURRENT new file mode 100644 index 0000000..1a84852 --- /dev/null +++ b/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/CURRENT @@ -0,0 +1 @@ +MANIFEST-000002 diff --git a/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/LOCK b/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/LOCK new file mode 100644 index 0000000..e69de29 diff --git a/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/MANIFEST-000002 b/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/MANIFEST-000002 new file mode 100644 index 0000000000000000000000000000000000000000..bbbc585686bcbcc33686059c69d80b7b4e1291cd GIT binary patch literal 50 zcmWIhx#Ncn10$nUPHI_dPD+xVQ)NkNd1i5{bAE0?Vo_pAe$kRS-TOEg7@3$k8JJmE F7y#sj5K{mE literal 0 HcmV?d00001 diff --git a/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/index.drunk_curran b/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/index.drunk_curran new file mode 100644 index 0000000000000000000000000000000000000000..f8177ae8d817d9a88414bb250b896e9efe52fd48 GIT binary patch literal 85 zcmV-b0IL5T^rFR5%iqHWxRc#|E_Ap6_w}7hYU3Qxuy0}5A@RKaESoKN6(NMW>@d;?Nx^qJ_!Z@!aOT% literal 0 HcmV?d00001 diff --git a/.nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/000003.log b/.nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/000003.log new file mode 100644 index 0000000000000000000000000000000000000000..6ab8989fffd9af638f4edb81091b6d1d1996e98c GIT binary patch literal 693 zcma)4J!}&(7|nNv;gFD+nLHqs<#J8aG+9X-sYt2Xp%nu{k#pxGCTIKNpS0bX5i2Vb zENqA!!N}ANA*M#Hgj7L#LKF#voiu_G54Ju(zxO>qd++Ht@hSkQ%!gm$#^`$M;ftf! zpSMrmKi?UZdrz)HUH-cgDic9|{#0o;EJXIK73yG#sex=Hk4i+qKf2n^A~ z9ybgZ>_yS zAPAozP*${aq7A-Xdx?M^urjDPzU^~XhQEJ2`*rbPCa219dNHr&4W0TWxAd+~9E;1; z<`W41UT$6HIZX_cLf`7}!YnSDNMQ&Qbm~~d7|M$>@U|1h3MY3IT*J8UZ3&DcVR_FC z6eX#~D>zE~IOf8{X?#zrVZ6wpr;W|BSY*Z;sTj%QjdmQ*L^j$u8d<6iF%yL~)yxSK z97$_3Zt&9D5{~GYK~@^e&04nFXdrMd?Zh=m3VZGY;gm~t;WkpHzqrLP?qMpv`&lWedc?6n+V1002%i2-5%n literal 0 HcmV?d00001 diff --git a/.nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/000003.log b/.nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/000003.log new file mode 100644 index 0000000000000000000000000000000000000000..fbd43390ba4a72ee4e7278c397e8d6103a60b0d2 GIT binary patch literal 3475 zcmdtkPiPcZ7y$6RnJBJ@YQcl_G>4XW*`1yLGti<&11-e12WbzjEN|w$N5;&b?aZ51 zFBPSSmKLi}P!A1l?V$~YrUm;4s)!V-LJvIz6+E?W4K0+QgBnrkH=Ergo5kQEA&@=H z?(CcQy>Gtv{r!5bB%#6yIp`vrL^n@yGRZ_s>P2JRBeX<@h?(w;wlfCF6cj z*_kBx(6FE8NJQwZi)gxk;png*jZ*S5PDl3OY4n_kI8H}v{!N4;dXTdqK2WJAu}9N1 zPAYq0?3J6SUqmU#Ji8;JU9atVeRyc^(61sI!ReHU6h$^oO=S}zig4HzQIbW20ZzHJ zP5W9z^q`*$eK0?BLq9K_zx(;4nSHHrNnSd2fA(&6L5SX-n-^K#f>~iqvY?5C`Ip-j z2LbiCA4lo)Lt&kFUet>tj{S(qKT2W7bxWcQ#{ekY^JA<2*G8Lwy+ z2BEQ3jx)|eE)AFiQkgbzkWopYWvw;Pezp|=o`Zy1`C;x&LDC0cY2x1&(eLQ#k|`$0 zo$6N|g($>v3A0^dQb%VV#=7TvB7!`#CM@99vpYpeLK?=&4E#a-^k4Ymepn3C=x%XM zk~pd1qQL*btrv&&fbwSPtM*QjEWyQC=^wxa1q_PWrOn0ObH72sQR#-+CkW2TO@9Jg zp^NS5myZ4Ry%pwT`cL21>h#u1vn}@jNo*ZQ)`(5LAA8xVy=)(Mu^pRPBW%^xV%w>{ z<*J%x5~e#;(_I@ggIQJ6pw=?6{i3~7b8No^6LV~#tzU8wx9Xz zg`F$ScEb{EJx8u8wrzjc%U0=Sn|HB&@4*`Bw#sU;?NncJ2r&##uTo91;li+ntE!+Kjar0`-C0tO0!+R1Y3*A zo@1Kk*KDy>68Js!Y59nLUojvNvt?o;0|xUvOpT0E<@U{?|OY6!$1> r)!BiGP5{XPh=HBeTtMR(4nL!yB|!jx$!28%j&**v^uTsq0zhH_sRb%N literal 0 HcmV?d00001 diff --git a/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/000003.log b/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/000003.log new file mode 100644 index 0000000..e69de29 diff --git a/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/CURRENT b/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/CURRENT new file mode 100644 index 0000000..1a84852 --- /dev/null +++ b/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/CURRENT @@ -0,0 +1 @@ +MANIFEST-000002 diff --git a/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/LOCK b/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/LOCK new file mode 100644 index 0000000..e69de29 diff --git a/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/MANIFEST-000002 b/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/MANIFEST-000002 new file mode 100644 index 0000000000000000000000000000000000000000..bbbc585686bcbcc33686059c69d80b7b4e1291cd GIT binary patch literal 50 zcmWIhx#Ncn10$nUPHI_dPD+xVQ)NkNd1i5{bAE0?Vo_pAe$kRS-TOEg7@3$k8JJmE F7y#sj5K{mE literal 0 HcmV?d00001 diff --git a/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/index.pedantic_rubens b/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/index.pedantic_rubens new file mode 100644 index 0000000..e69de29 diff --git a/.nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/000003.log b/.nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/000003.log new file mode 100644 index 0000000000000000000000000000000000000000..4fb2969346d4954a7a28c8326bf0a9f69ab9de42 GIT binary patch literal 720 zcma)4&ubGw7|pj658IPx4>|{-r_DA$+O!7`rVUs~)k8s4N|@}8QzG8>VC-<*D z`CNWKE{}rVwO2RZyuJjbM`TDU*08j4Qz`6hP3CNm6-K$&`$!)>2jW9kzQ49s+HMu~P)wclPdf+WYMj1bw2<5JZh|eXB}0 z-y#r%PY@_8S}D;v0y<*3S8`n2<1F{TKl}1~b}(J_qokaxUWPoauQ6Vxlt_?8w=R**Stwa52LLAzV(S88_D& z(Ry=htSDc63TI7kBHJ|#06?+^kpKVy literal 0 HcmV?d00001 diff --git a/.nextflow/history b/.nextflow/history new file mode 100644 index 0000000..a20c419 --- /dev/null +++ b/.nextflow/history @@ -0,0 +1,10 @@ +2021-02-23 10:34:41 1.4s tiny_saha OK 0e6d4aa3ece9f4af1bef44a544b32c03 a33372da-190e-4d40-a449-71e610806fc2 nextflow run main.nf +2021-02-23 10:55:05 850ms marvelous_kare OK 17ee5c59e3ecb963d93db304071b6f52 44a9c761-7c53-4e93-985b-3efc6907178e nextflow run main.nf +2021-02-23 10:58:02 2.1s fabulous_fermat OK 6593265ff7966308764153332014de1a 82425c5e-2c2c-408c-b892-c2f085aed751 nextflow run main.nf +2021-02-23 10:59:49 2.2s loving_gautier OK 90b303acac3eaf67d60804459112c000 6cc9b687-9f88-4abd-b1c2-34d13dedccaa nextflow run main.nf +2021-02-23 17:50:37 2.4s reverent_leavitt OK 8c0baa17989a28a9835bca03ecc025f2 ffccacf1-a0d4-4d67-a60d-6d78f86640e8 nextflow run main.nf +2021-02-23 17:57:07 2.4s pedantic_rubens ERR 3bfdc02ef42ae7cf971c669d297383e3 e38dcb45-706f-4949-9d2c-76fafacf54dd nextflow run main.nf +2021-02-23 17:57:42 2.1s special_plateau OK 3dd7a0c300b3f395e581795ead49d352 e25eb517-482a-4dc2-8c08-e6575b46df44 nextflow run main.nf +2021-02-23 17:58:07 2.2s trusting_pike OK 7228a16b595e1e688ad63480da1bdd3f 7d3f89a6-bccf-443b-bd4a-3a96c7f57638 nextflow run main.nf +2021-02-23 17:58:47 2.6s modest_noether OK 0a507e6896a0681ea9647fb7cd6c381a e28879fe-8327-4035-8a19-947fb5ce86d4 nextflow run main.nf +2021-02-23 18:00:52 3.3s drunk_curran OK d54b25fd7c49e69b8ed322c953ea6b0a ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8 nextflow run main.nf diff --git a/DB/blastDB.nhr b/DB/blastDB.nhr new file mode 100644 index 0000000000000000000000000000000000000000..15d8333d2a926b973f7d7b43aa72c645e70209ea GIT binary patch literal 408 zcmXqLFlboNASD=_oS2rDpOX@A7;mVjXJ}x+z_1V~wF)B5>EsjdALJ76=>ig7(7?pV zfD9HP1PmY=gptiN0Gen-&_om?@tbG_GSQfziA==1(HLZ+2|*K?i8s*%WTGiS6IpPW F2ms7$U{U}8 literal 0 HcmV?d00001 diff --git a/DB/blastDB.nin b/DB/blastDB.nin new file mode 100644 index 0000000000000000000000000000000000000000..f3e3fbb1096bebb7655c190b3ff6c3d6cb5b555b GIT binary patch literal 144 zcmZQzU|?Z@0Pf7Zg3=Pbw8Y|)M4*VQTWXSmk+F_~k%5t+f`Xxem8rRcqc2o3kYfG9 q21Yn*y;v5N85$GZ14FYX$&+RS@t1 literal 0 HcmV?d00001 diff --git a/DB/blastDB.nsq b/DB/blastDB.nsq new file mode 100644 index 0000000000000000000000000000000000000000..e3a56cdc5afb463c6fe8220d66dcbfe27854a92b GIT binary patch literal 131 zcmV-}0DS)dN81~p0`Du* z`@E0)Pl_}Ep#O9T_d6b3N0tgpjB>bv_3+^iIW6)$$pGy=elgHNBwZsZ49ySIB@auJ li1O(2Km>9CG>^p9S4g-IPtdI)%_0;Cqt(-0J_S#oR{-G9JFNf! literal 0 HcmV?d00001 diff --git a/input.fasta b/input.fasta new file mode 100644 index 0000000..fdc0c85 --- /dev/null +++ b/input.fasta @@ -0,0 +1,10 @@ +>Scaffold_1_1..100 +CAGGCAAAATGTGGCACAAAAACAACAAATTGTTTAGTAGATACAGGGGCATCCATTTGTTGTATTTCGTCTGCTTTTCTGAGCACAGCTTTTGAAAACC +>Scaffold_1_101..200 +TTACTCTTGGAAACTCACCCTTTCCACAGGTAAAAGGTGTTGGCGGCGAATTGCATAAAGTGTTAGGTTCAGTTGTGTTAGATTTTGTCATTGAGGATCA +>Scaffold_1_201..300 +GGAATTTTCTCAAAGATTCTATGTACTGCCTACACTGCCGAAGGCAGTGATACTAGGTGAGAACTTCCTTAATGACAATGATGCAGTCTTAGATTATAGC +>Scaffold_1_301..400 +TGTCATTCCTTGATACTCAACAACAGCACCTCAGATAGGCAATATATCAATTTCATAGCCAATTCAGTGCATGAGATTAGTGGATTAGCAAAAACACTAG +>Scaffold_1_401..500 +ATCAGATTTACATCCCCCCTCAGAGTGAAATTCATTTCAAGGTCAGACTATCAGAGACCAAAGAGGATTCCCTCATCCTCATTGAACCCATTGCTTCCCT diff --git a/out_dir/blastout/input.blastout b/out_dir/blastout/input.blastout new file mode 120000 index 0000000..8dc94f0 --- /dev/null +++ b/out_dir/blastout/input.blastout @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/work/7f/c96665018e757eb6f4c0765d024062/input.blastout \ No newline at end of file diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.begin b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.err b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.log b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.out b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.run b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.run new file mode 100644 index 0000000..ea8fcf1 --- /dev/null +++ b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (3) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.3.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta input.3.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.sh b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.sh new file mode 100644 index 0000000..3ff5a9f --- /dev/null +++ b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.3.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.3.fasta b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.3.fasta new file mode 120000 index 0000000..49c43da --- /dev/null +++ b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.3.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta \ No newline at end of file diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.blastout b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.blastout new file mode 100644 index 0000000..9ff0e96 --- /dev/null +++ b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.blastout @@ -0,0 +1 @@ +Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.begin b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.err b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.log b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.out b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.run b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.run new file mode 100644 index 0000000..3dc5390 --- /dev/null +++ b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (3) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.3.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta input.3.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.sh b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.sh new file mode 100644 index 0000000..3ff5a9f --- /dev/null +++ b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.3.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.exitcode b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.3.fasta b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.3.fasta new file mode 120000 index 0000000..419cf6b --- /dev/null +++ b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.3.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta \ No newline at end of file diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.blastout b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.blastout new file mode 100644 index 0000000..9ff0e96 --- /dev/null +++ b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.blastout @@ -0,0 +1 @@ +Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/20/a023d9c641eb2e9b732797e1a39b21/.chunks.input.fasta b/work/20/a023d9c641eb2e9b732797e1a39b21/.chunks.input.fasta new file mode 100644 index 0000000000000000000000000000000000000000..64abc0829295672ed9460c199708029c26c32dc2 GIT binary patch literal 513 zcmcJ|u?+$t6aY{u+`u{b2b>a0dwWas@gPAFF7WYmR%Scaffold_1_1..100 +CAGGCAAAATGTGGCACAAAAACAACAAATTGTTTAGTAGATACAGGGGCATCCATTTGTTGTATTTCGTCTGCTTTTCTGAGCACAGCTTTTGAAAACC diff --git a/work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta b/work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta new file mode 100644 index 0000000..e459aa6 --- /dev/null +++ b/work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta @@ -0,0 +1,2 @@ +>Scaffold_1_101..200 +TTACTCTTGGAAACTCACCCTTTCCACAGGTAAAAGGTGTTGGCGGCGAATTGCATAAAGTGTTAGGTTCAGTTGTGTTAGATTTTGTCATTGAGGATCA diff --git a/work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta b/work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta new file mode 100644 index 0000000..b8b2c14 --- /dev/null +++ b/work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta @@ -0,0 +1,2 @@ +>Scaffold_1_201..300 +GGAATTTTCTCAAAGATTCTATGTACTGCCTACACTGCCGAAGGCAGTGATACTAGGTGAGAACTTCCTTAATGACAATGATGCAGTCTTAGATTATAGC diff --git a/work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta b/work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta new file mode 100644 index 0000000..732f920 --- /dev/null +++ b/work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta @@ -0,0 +1,2 @@ +>Scaffold_1_301..400 +TGTCATTCCTTGATACTCAACAACAGCACCTCAGATAGGCAATATATCAATTTCATAGCCAATTCAGTGCATGAGATTAGTGGATTAGCAAAAACACTAG diff --git a/work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta b/work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta new file mode 100644 index 0000000..2991afa --- /dev/null +++ b/work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta @@ -0,0 +1,2 @@ +>Scaffold_1_401..500 +ATCAGATTTACATCCCCCCTCAGAGTGAAATTCATTTCAAGGTCAGACTATCAGAGACCAAAGAGGATTCCCTCATCCTCATTGAACCCATTGCTTCCCT diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.begin b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.err b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.log b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.out b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.run b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.run new file mode 100644 index 0000000..0d4a3b0 --- /dev/null +++ b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.run @@ -0,0 +1,103 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/26/04e3f135871f67b7aa32f7a492afd3/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/26/04e3f135871f67b7aa32f7a492afd3/.command.sh +} + +nxf_stage() { + true +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/26/04e3f135871f67b7aa32f7a492afd3/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.sh b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.sh new file mode 100644 index 0000000..3e62c00 --- /dev/null +++ b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query /mnt/d/Work/nextflow_stuff/nftutorial/input.fasta -outfmt 6 -out input.blastout diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.exitcode b/work/26/04e3f135871f67b7aa32f7a492afd3/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/26/04e3f135871f67b7aa32f7a492afd3/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/input.blastout b/work/26/04e3f135871f67b7aa32f7a492afd3/input.blastout new file mode 100644 index 0000000..8cab1da --- /dev/null +++ b/work/26/04e3f135871f67b7aa32f7a492afd3/input.blastout @@ -0,0 +1,5 @@ +Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.begin b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.err b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.log b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.out b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.run b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.run new file mode 100644 index 0000000..fa1d05f --- /dev/null +++ b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (1) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/3f/a7cae8fdde157089440ff4d2e77089/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/3f/a7cae8fdde157089440ff4d2e77089/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.1.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.1.fasta input.1.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/3f/a7cae8fdde157089440ff4d2e77089/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.sh b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.sh new file mode 100644 index 0000000..ef144d5 --- /dev/null +++ b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.1.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.exitcode b/work/3f/a7cae8fdde157089440ff4d2e77089/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/3f/a7cae8fdde157089440ff4d2e77089/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/input.1.fasta b/work/3f/a7cae8fdde157089440ff4d2e77089/input.1.fasta new file mode 120000 index 0000000..f5fa4eb --- /dev/null +++ b/work/3f/a7cae8fdde157089440ff4d2e77089/input.1.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.1.fasta \ No newline at end of file diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/input.blastout b/work/3f/a7cae8fdde157089440ff4d2e77089/input.blastout new file mode 100644 index 0000000..8922b57 --- /dev/null +++ b/work/3f/a7cae8fdde157089440ff4d2e77089/input.blastout @@ -0,0 +1 @@ +Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.begin b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.err b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.log b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.out b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.run b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.run new file mode 100644 index 0000000..7be94ab --- /dev/null +++ b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (1) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/71/0d3867a8d3b5de4fe7c5a25071f455/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/input.fasta input.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.sh b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.sh new file mode 100644 index 0000000..00a3ce3 --- /dev/null +++ b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.exitcode b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.blastout b/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.blastout new file mode 100644 index 0000000..8cab1da --- /dev/null +++ b/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.blastout @@ -0,0 +1,5 @@ +Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.fasta b/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.fasta new file mode 120000 index 0000000..6bfb745 --- /dev/null +++ b/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/input.fasta \ No newline at end of file diff --git a/work/71/990da57db0c2c80bed5070f36a2644/.chunks.input.fasta b/work/71/990da57db0c2c80bed5070f36a2644/.chunks.input.fasta new file mode 100644 index 0000000000000000000000000000000000000000..8f86e11ca3f2b60ac96616a5f042a0adb878df3e GIT binary patch literal 513 zcmcJ|F%rTc5CA|a{DJS_2nmTP?d>g{OUTWj2pMu1eXF%U@BxnF8>qKfvAN(KWoGB) zAtihs-SQFJognAmF9El}VBr+g6~gpj@^L*coQWV1XO79ChxNx@1%0n9n$8Yt)Z<Scaffold_1_1..100 +CAGGCAAAATGTGGCACAAAAACAACAAATTGTTTAGTAGATACAGGGGCATCCATTTGTTGTATTTCGTCTGCTTTTCTGAGCACAGCTTTTGAAAACC diff --git a/work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta b/work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta new file mode 100644 index 0000000..e459aa6 --- /dev/null +++ b/work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta @@ -0,0 +1,2 @@ +>Scaffold_1_101..200 +TTACTCTTGGAAACTCACCCTTTCCACAGGTAAAAGGTGTTGGCGGCGAATTGCATAAAGTGTTAGGTTCAGTTGTGTTAGATTTTGTCATTGAGGATCA diff --git a/work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta b/work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta new file mode 100644 index 0000000..b8b2c14 --- /dev/null +++ b/work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta @@ -0,0 +1,2 @@ +>Scaffold_1_201..300 +GGAATTTTCTCAAAGATTCTATGTACTGCCTACACTGCCGAAGGCAGTGATACTAGGTGAGAACTTCCTTAATGACAATGATGCAGTCTTAGATTATAGC diff --git a/work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta b/work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta new file mode 100644 index 0000000..732f920 --- /dev/null +++ b/work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta @@ -0,0 +1,2 @@ +>Scaffold_1_301..400 +TGTCATTCCTTGATACTCAACAACAGCACCTCAGATAGGCAATATATCAATTTCATAGCCAATTCAGTGCATGAGATTAGTGGATTAGCAAAAACACTAG diff --git a/work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta b/work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta new file mode 100644 index 0000000..2991afa --- /dev/null +++ b/work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta @@ -0,0 +1,2 @@ +>Scaffold_1_401..500 +ATCAGATTTACATCCCCCCTCAGAGTGAAATTCATTTCAAGGTCAGACTATCAGAGACCAAAGAGGATTCCCTCATCCTCATTGAACCCATTGCTTCCCT diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.begin b/work/7b/a74d9f937053b223d41e8145db2861/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.err b/work/7b/a74d9f937053b223d41e8145db2861/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.log b/work/7b/a74d9f937053b223d41e8145db2861/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.out b/work/7b/a74d9f937053b223d41e8145db2861/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.run b/work/7b/a74d9f937053b223d41e8145db2861/.command.run new file mode 100644 index 0000000..385fd2c --- /dev/null +++ b/work/7b/a74d9f937053b223d41e8145db2861/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (5) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/7b/a74d9f937053b223d41e8145db2861/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/7b/a74d9f937053b223d41e8145db2861/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.5.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta input.5.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/7b/a74d9f937053b223d41e8145db2861/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.sh b/work/7b/a74d9f937053b223d41e8145db2861/.command.sh new file mode 100644 index 0000000..c0e0afc --- /dev/null +++ b/work/7b/a74d9f937053b223d41e8145db2861/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.5.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.exitcode b/work/7b/a74d9f937053b223d41e8145db2861/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/7b/a74d9f937053b223d41e8145db2861/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/7b/a74d9f937053b223d41e8145db2861/input.5.fasta b/work/7b/a74d9f937053b223d41e8145db2861/input.5.fasta new file mode 120000 index 0000000..e1f3506 --- /dev/null +++ b/work/7b/a74d9f937053b223d41e8145db2861/input.5.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta \ No newline at end of file diff --git a/work/7b/a74d9f937053b223d41e8145db2861/input.blastout b/work/7b/a74d9f937053b223d41e8145db2861/input.blastout new file mode 100644 index 0000000..19fb367 --- /dev/null +++ b/work/7b/a74d9f937053b223d41e8145db2861/input.blastout @@ -0,0 +1 @@ +Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.begin b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.err b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.log b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.out b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.run b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.run new file mode 100644 index 0000000..787eb7a --- /dev/null +++ b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.run @@ -0,0 +1,103 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/8ee16d3455b4398f550baeec536ea1/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/8ee16d3455b4398f550baeec536ea1/.command.sh +} + +nxf_stage() { + true +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/8ee16d3455b4398f550baeec536ea1/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.sh b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.sh new file mode 100644 index 0000000..cc3edd4 --- /dev/null +++ b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB/blastDB -query /mnt/d/Work/nextflow_stuff/nftutorial/input.fasta -outfmt 6 -out input.blastout diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.exitcode b/work/7f/8ee16d3455b4398f550baeec536ea1/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/7f/8ee16d3455b4398f550baeec536ea1/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/input.blastout b/work/7f/8ee16d3455b4398f550baeec536ea1/input.blastout new file mode 100644 index 0000000..8cab1da --- /dev/null +++ b/work/7f/8ee16d3455b4398f550baeec536ea1/input.blastout @@ -0,0 +1,5 @@ +Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.begin b/work/7f/c96665018e757eb6f4c0765d024062/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.err b/work/7f/c96665018e757eb6f4c0765d024062/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.log b/work/7f/c96665018e757eb6f4c0765d024062/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.out b/work/7f/c96665018e757eb6f4c0765d024062/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.run b/work/7f/c96665018e757eb6f4c0765d024062/.command.run new file mode 100644 index 0000000..4d8a605 --- /dev/null +++ b/work/7f/c96665018e757eb6f4c0765d024062/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (5) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/c96665018e757eb6f4c0765d024062/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/c96665018e757eb6f4c0765d024062/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.5.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta input.5.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/c96665018e757eb6f4c0765d024062/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.sh b/work/7f/c96665018e757eb6f4c0765d024062/.command.sh new file mode 100644 index 0000000..c0e0afc --- /dev/null +++ b/work/7f/c96665018e757eb6f4c0765d024062/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.5.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.exitcode b/work/7f/c96665018e757eb6f4c0765d024062/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/7f/c96665018e757eb6f4c0765d024062/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/7f/c96665018e757eb6f4c0765d024062/input.5.fasta b/work/7f/c96665018e757eb6f4c0765d024062/input.5.fasta new file mode 120000 index 0000000..5cd38cf --- /dev/null +++ b/work/7f/c96665018e757eb6f4c0765d024062/input.5.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta \ No newline at end of file diff --git a/work/7f/c96665018e757eb6f4c0765d024062/input.blastout b/work/7f/c96665018e757eb6f4c0765d024062/input.blastout new file mode 100644 index 0000000..19fb367 --- /dev/null +++ b/work/7f/c96665018e757eb6f4c0765d024062/input.blastout @@ -0,0 +1 @@ +Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.begin b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.err b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.log b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.out b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.run b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.run new file mode 100644 index 0000000..3374abf --- /dev/null +++ b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (4) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/8b/56e6fed73cb914f7286cd5d981894e/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/8b/56e6fed73cb914f7286cd5d981894e/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.4.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta input.4.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/8b/56e6fed73cb914f7286cd5d981894e/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.sh b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.sh new file mode 100644 index 0000000..7626a47 --- /dev/null +++ b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.4.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.exitcode b/work/8b/56e6fed73cb914f7286cd5d981894e/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/8b/56e6fed73cb914f7286cd5d981894e/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/input.4.fasta b/work/8b/56e6fed73cb914f7286cd5d981894e/input.4.fasta new file mode 120000 index 0000000..415c0aa --- /dev/null +++ b/work/8b/56e6fed73cb914f7286cd5d981894e/input.4.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta \ No newline at end of file diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/input.blastout b/work/8b/56e6fed73cb914f7286cd5d981894e/input.blastout new file mode 100644 index 0000000..05980cb --- /dev/null +++ b/work/8b/56e6fed73cb914f7286cd5d981894e/input.blastout @@ -0,0 +1 @@ +Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.begin b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.err b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.log b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.out b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.run b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.run new file mode 100644 index 0000000..be03af5 --- /dev/null +++ b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (2) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/99/3d8ec7b2376df49e34b8af5f7065e7/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.2.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta input.2.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.sh b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.sh new file mode 100644 index 0000000..1b99561 --- /dev/null +++ b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.2.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.exitcode b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.2.fasta b/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.2.fasta new file mode 120000 index 0000000..eca20fe --- /dev/null +++ b/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.2.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta \ No newline at end of file diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.blastout b/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.blastout new file mode 100644 index 0000000..8868ada --- /dev/null +++ b/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.blastout @@ -0,0 +1 @@ +Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.begin b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.err b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.log b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.out b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.run b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.run new file mode 100644 index 0000000..e3c43ef --- /dev/null +++ b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (1) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/ba/95f5736be825ad1c7b0bd16ad91e73/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/input.fasta input.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.sh b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.sh new file mode 100644 index 0000000..00a3ce3 --- /dev/null +++ b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.exitcode b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.blastout b/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.blastout new file mode 100644 index 0000000..8cab1da --- /dev/null +++ b/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.blastout @@ -0,0 +1,5 @@ +Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.fasta b/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.fasta new file mode 120000 index 0000000..6bfb745 --- /dev/null +++ b/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/input.fasta \ No newline at end of file diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.begin b/work/c4/47cf90196657efefed5587143e0906/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.err b/work/c4/47cf90196657efefed5587143e0906/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.log b/work/c4/47cf90196657efefed5587143e0906/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.out b/work/c4/47cf90196657efefed5587143e0906/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.run b/work/c4/47cf90196657efefed5587143e0906/.command.run new file mode 100644 index 0000000..711f7c5 --- /dev/null +++ b/work/c4/47cf90196657efefed5587143e0906/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (4) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/47cf90196657efefed5587143e0906/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/47cf90196657efefed5587143e0906/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.4.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta input.4.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/47cf90196657efefed5587143e0906/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.sh b/work/c4/47cf90196657efefed5587143e0906/.command.sh new file mode 100644 index 0000000..7626a47 --- /dev/null +++ b/work/c4/47cf90196657efefed5587143e0906/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.4.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/c4/47cf90196657efefed5587143e0906/.exitcode b/work/c4/47cf90196657efefed5587143e0906/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/c4/47cf90196657efefed5587143e0906/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/c4/47cf90196657efefed5587143e0906/input.4.fasta b/work/c4/47cf90196657efefed5587143e0906/input.4.fasta new file mode 120000 index 0000000..cc53fa4 --- /dev/null +++ b/work/c4/47cf90196657efefed5587143e0906/input.4.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta \ No newline at end of file diff --git a/work/c4/47cf90196657efefed5587143e0906/input.blastout b/work/c4/47cf90196657efefed5587143e0906/input.blastout new file mode 100644 index 0000000..05980cb --- /dev/null +++ b/work/c4/47cf90196657efefed5587143e0906/input.blastout @@ -0,0 +1 @@ +Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.begin b/work/c4/591e87d704c57904782d621fa23dac/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.err b/work/c4/591e87d704c57904782d621fa23dac/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.log b/work/c4/591e87d704c57904782d621fa23dac/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.out b/work/c4/591e87d704c57904782d621fa23dac/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.run b/work/c4/591e87d704c57904782d621fa23dac/.command.run new file mode 100644 index 0000000..a5c2d75 --- /dev/null +++ b/work/c4/591e87d704c57904782d621fa23dac/.command.run @@ -0,0 +1,103 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/591e87d704c57904782d621fa23dac/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/591e87d704c57904782d621fa23dac/.command.sh +} + +nxf_stage() { + true +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/591e87d704c57904782d621fa23dac/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.sh b/work/c4/591e87d704c57904782d621fa23dac/.command.sh new file mode 100644 index 0000000..772cd69 --- /dev/null +++ b/work/c4/591e87d704c57904782d621fa23dac/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query /mnt/d/Work/nextflow_stuff/nftutorial/input.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/c4/591e87d704c57904782d621fa23dac/.exitcode b/work/c4/591e87d704c57904782d621fa23dac/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/c4/591e87d704c57904782d621fa23dac/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/c4/591e87d704c57904782d621fa23dac/input.blastout b/work/c4/591e87d704c57904782d621fa23dac/input.blastout new file mode 100644 index 0000000..8cab1da --- /dev/null +++ b/work/c4/591e87d704c57904782d621fa23dac/input.blastout @@ -0,0 +1,5 @@ +Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 +Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.begin b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.err b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.log b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.out b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.run b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.run new file mode 100644 index 0000000..3e1e816 --- /dev/null +++ b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (1) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/c9/0188819dd55c40e3180e3fa3a02541/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/c9/0188819dd55c40e3180e3fa3a02541/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.1.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.1.fasta input.1.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/c9/0188819dd55c40e3180e3fa3a02541/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.sh b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.sh new file mode 100644 index 0000000..ef144d5 --- /dev/null +++ b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.1.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.exitcode b/work/c9/0188819dd55c40e3180e3fa3a02541/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/c9/0188819dd55c40e3180e3fa3a02541/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/input.1.fasta b/work/c9/0188819dd55c40e3180e3fa3a02541/input.1.fasta new file mode 120000 index 0000000..f80d8bf --- /dev/null +++ b/work/c9/0188819dd55c40e3180e3fa3a02541/input.1.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.1.fasta \ No newline at end of file diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/input.blastout b/work/c9/0188819dd55c40e3180e3fa3a02541/input.blastout new file mode 100644 index 0000000..8922b57 --- /dev/null +++ b/work/c9/0188819dd55c40e3180e3fa3a02541/input.blastout @@ -0,0 +1 @@ +Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.begin b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.begin new file mode 100644 index 0000000..e69de29 diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.err b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.err new file mode 100644 index 0000000..e69de29 diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.log b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.log new file mode 100644 index 0000000..e69de29 diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.out b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.out new file mode 100644 index 0000000..e69de29 diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.run b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.run new file mode 100644 index 0000000..cdfc3b0 --- /dev/null +++ b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.run @@ -0,0 +1,106 @@ +#!/bin/bash +# NEXTFLOW TASK: runBlast (2) +set -e +set -u +NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x +NXF_ENTRY=${1:-nxf_main} + + +nxf_date() { + local ts=$(date +%s%3N); + if [[ ${#ts} == 10 ]]; then echo ${ts}000 + elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} + elif [[ $ts == *3N ]]; then echo ${ts/3N/000} + elif [[ ${#ts} == 13 ]]; then echo $ts + else echo "Unexpected timestamp value: $ts"; exit 1 + fi +} + +nxf_env() { + echo '============= task environment =============' + env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" + echo '============= task output ==================' +} + +nxf_kill() { + declare -a children + while read P PP;do + children[$PP]+=" $P" + done < <(ps -e -o pid= -o ppid=) + + kill_all() { + [[ $1 != $$ ]] && kill $1 2>/dev/null || true + for i in ${children[$1]:=}; do kill_all $i; done + } + + kill_all $1 +} + +nxf_mktemp() { + local base=${1:-/tmp} + if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX + else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX + fi +} + +on_exit() { + exit_status=${nxf_main_ret:=$?} + printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode + set +u + [[ "$tee1" ]] && kill $tee1 2>/dev/null + [[ "$tee2" ]] && kill $tee2 2>/dev/null + [[ "$ctmp" ]] && rm -rf $ctmp || true + exit $exit_status +} + +on_term() { + set +e + [[ "$pid" ]] && nxf_kill $pid +} + +nxf_launch() { + /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.sh +} + +nxf_stage() { + true + # stage input files + rm -f input.2.fasta + ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta input.2.fasta +} + +nxf_unstage() { + true + [[ ${nxf_main_ret:=0} != 0 ]] && return +} + +nxf_main() { + trap on_exit EXIT + trap on_term TERM INT USR2 + trap '' USR1 + + [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" + NXF_SCRATCH='' + [[ $NXF_DEBUG > 0 ]] && nxf_env + touch /mnt/d/Work/nextflow_stuff/nftutorial/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.begin + set +u + set -u + [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH + nxf_stage + + set +e + local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) + local cout=$ctmp/.command.out; mkfifo $cout + local cerr=$ctmp/.command.err; mkfifo $cerr + tee .command.out < $cout & + tee1=$! + tee .command.err < $cerr >&2 & + tee2=$! + ( nxf_launch ) >$cout 2>$cerr & + pid=$! + wait $pid || nxf_main_ret=$? + wait $tee1 $tee2 + nxf_unstage +} + +$NXF_ENTRY diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.sh b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.sh new file mode 100644 index 0000000..1b99561 --- /dev/null +++ b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.sh @@ -0,0 +1,2 @@ +#!/bin/bash -ue +blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.2.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode new file mode 100644 index 0000000..c227083 --- /dev/null +++ b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode @@ -0,0 +1 @@ +0 \ No newline at end of file diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.2.fasta b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.2.fasta new file mode 120000 index 0000000..c5cca71 --- /dev/null +++ b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.2.fasta @@ -0,0 +1 @@ +/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta \ No newline at end of file diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.blastout b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.blastout new file mode 100644 index 0000000..8868ada --- /dev/null +++ b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.blastout @@ -0,0 +1 @@ +Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 From 98e5feb181b25b7a213f1e2d86218b76cab63461 Mon Sep 17 00:00:00 2001 From: Flip Mulder Date: Thu, 25 Feb 2021 14:15:16 +0100 Subject: [PATCH 5/6] Test commit retry --- .nextflow.log | 55 --------- .nextflow.log.1 | 52 --------- .nextflow.log.2 | 39 ------- .nextflow.log.3 | 40 ------- .nextflow.log.4 | 55 --------- .nextflow.log.5 | 39 ------- .nextflow.log.6 | 39 ------- .nextflow.log.7 | 39 ------- .nextflow.log.8 | 32 ------ .nextflow.log.9 | 32 ------ .../db/000003.log | 0 .../db/CURRENT | 1 - .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 50 -> 0 bytes .../index.marvelous_kare | 0 .../db/000003.log | Bin 704 -> 0 bytes .../db/CURRENT | 1 - .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 50 -> 0 bytes .../index.loving_gautier | Bin 17 -> 0 bytes .../db/000003.log | Bin 693 -> 0 bytes .../db/CURRENT | 1 - .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 50 -> 0 bytes .../index.trusting_pike | Bin 17 -> 0 bytes .../db/000003.log | Bin 703 -> 0 bytes .../db/CURRENT | 1 - .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 50 -> 0 bytes .../index.fabulous_fermat | Bin 17 -> 0 bytes .../db/000003.log | 0 .../db/CURRENT | 1 - .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 50 -> 0 bytes .../index.tiny_saha | 0 .../db/000003.log | Bin 3477 -> 0 bytes .../db/CURRENT | 1 - .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 50 -> 0 bytes .../index.drunk_curran | Bin 85 -> 0 bytes .../db/000003.log | Bin 693 -> 0 bytes .../db/CURRENT | 1 - .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 50 -> 0 bytes .../index.special_plateau | Bin 17 -> 0 bytes .../db/000003.log | Bin 3475 -> 0 bytes .../db/CURRENT | 1 - .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 50 -> 0 bytes .../index.modest_noether | Bin 85 -> 0 bytes .../db/000003.log | 0 .../db/CURRENT | 1 - .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 50 -> 0 bytes .../index.pedantic_rubens | 0 .../db/000003.log | Bin 720 -> 0 bytes .../db/CURRENT | 1 - .../db/LOCK | 0 .../db/MANIFEST-000002 | Bin 50 -> 0 bytes .../index.reverent_leavitt | Bin 17 -> 0 bytes .nextflow/history | 10 -- .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode | 1 - .../input.3.fasta | 1 - .../input.blastout | 1 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../f4a2c552cbdfc306b893dd7d2e74b8/.exitcode | 1 - .../input.3.fasta | 1 - .../input.blastout | 1 - .../.chunks.input.fasta | Bin 513 -> 0 bytes .../input.1.fasta | 2 - .../input.2.fasta | 2 - .../input.3.fasta | 2 - .../input.4.fasta | 2 - .../input.5.fasta | 2 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 103 ----------------- .../.command.sh | 2 - .../04e3f135871f67b7aa32f7a492afd3/.exitcode | 1 - .../input.blastout | 5 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../a7cae8fdde157089440ff4d2e77089/.exitcode | 1 - .../input.1.fasta | 1 - .../input.blastout | 1 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../0d3867a8d3b5de4fe7c5a25071f455/.exitcode | 1 - .../input.blastout | 5 - .../input.fasta | 1 - .../.chunks.input.fasta | Bin 513 -> 0 bytes .../input.1.fasta | 2 - .../input.2.fasta | 2 - .../input.3.fasta | 2 - .../input.4.fasta | 2 - .../input.5.fasta | 2 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../a74d9f937053b223d41e8145db2861/.exitcode | 1 - .../input.5.fasta | 1 - .../input.blastout | 1 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 103 ----------------- .../.command.sh | 2 - .../8ee16d3455b4398f550baeec536ea1/.exitcode | 1 - .../input.blastout | 5 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../c96665018e757eb6f4c0765d024062/.exitcode | 1 - .../input.5.fasta | 1 - .../input.blastout | 1 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../56e6fed73cb914f7286cd5d981894e/.exitcode | 1 - .../input.4.fasta | 1 - .../input.blastout | 1 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../3d8ec7b2376df49e34b8af5f7065e7/.exitcode | 1 - .../input.2.fasta | 1 - .../input.blastout | 1 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../95f5736be825ad1c7b0bd16ad91e73/.exitcode | 1 - .../input.blastout | 5 - .../input.fasta | 1 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../47cf90196657efefed5587143e0906/.exitcode | 1 - .../input.4.fasta | 1 - .../input.blastout | 1 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 103 ----------------- .../.command.sh | 2 - .../591e87d704c57904782d621fa23dac/.exitcode | 1 - .../input.blastout | 5 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../0188819dd55c40e3180e3fa3a02541/.exitcode | 1 - .../input.1.fasta | 1 - .../input.blastout | 1 - .../.command.begin | 0 .../.command.err | 0 .../.command.log | 0 .../.command.out | 0 .../.command.run | 106 ------------------ .../.command.sh | 2 - .../f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode | 1 - .../input.2.fasta | 1 - .../input.blastout | 1 - 205 files changed, 2135 deletions(-) delete mode 100644 .nextflow.log delete mode 100644 .nextflow.log.1 delete mode 100644 .nextflow.log.2 delete mode 100644 .nextflow.log.3 delete mode 100644 .nextflow.log.4 delete mode 100644 .nextflow.log.5 delete mode 100644 .nextflow.log.6 delete mode 100644 .nextflow.log.7 delete mode 100644 .nextflow.log.8 delete mode 100644 .nextflow.log.9 delete mode 100644 .nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/000003.log delete mode 100644 .nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/CURRENT delete mode 100644 .nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/LOCK delete mode 100644 .nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/MANIFEST-000002 delete mode 100644 .nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/index.marvelous_kare delete mode 100644 .nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/000003.log delete mode 100644 .nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/CURRENT delete mode 100644 .nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/LOCK delete mode 100644 .nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/MANIFEST-000002 delete mode 100644 .nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/index.loving_gautier delete mode 100644 .nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/000003.log delete mode 100644 .nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/CURRENT delete mode 100644 .nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/LOCK delete mode 100644 .nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/MANIFEST-000002 delete mode 100644 .nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/index.trusting_pike delete mode 100644 .nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/000003.log delete mode 100644 .nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/CURRENT delete mode 100644 .nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/LOCK delete mode 100644 .nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/MANIFEST-000002 delete mode 100644 .nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/index.fabulous_fermat delete mode 100644 .nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/000003.log delete mode 100644 .nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/CURRENT delete mode 100644 .nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/LOCK delete mode 100644 .nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/MANIFEST-000002 delete mode 100644 .nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/index.tiny_saha delete mode 100644 .nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/000003.log delete mode 100644 .nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/CURRENT delete mode 100644 .nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/LOCK delete mode 100644 .nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/MANIFEST-000002 delete mode 100644 .nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/index.drunk_curran delete mode 100644 .nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/000003.log delete mode 100644 .nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/CURRENT delete mode 100644 .nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/LOCK delete mode 100644 .nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/MANIFEST-000002 delete mode 100644 .nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/index.special_plateau delete mode 100644 .nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/000003.log delete mode 100644 .nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/CURRENT delete mode 100644 .nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/LOCK delete mode 100644 .nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/MANIFEST-000002 delete mode 100644 .nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/index.modest_noether delete mode 100644 .nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/000003.log delete mode 100644 .nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/CURRENT delete mode 100644 .nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/LOCK delete mode 100644 .nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/MANIFEST-000002 delete mode 100644 .nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/index.pedantic_rubens delete mode 100644 .nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/000003.log delete mode 100644 .nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/CURRENT delete mode 100644 .nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/LOCK delete mode 100644 .nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/MANIFEST-000002 delete mode 100644 .nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/index.reverent_leavitt delete mode 100644 .nextflow/history delete mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.begin delete mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.err delete mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.log delete mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.out delete mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.run delete mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.sh delete mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode delete mode 120000 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.3.fasta delete mode 100644 work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.blastout delete mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.begin delete mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.err delete mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.log delete mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.out delete mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.run delete mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.sh delete mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.exitcode delete mode 120000 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.3.fasta delete mode 100644 work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.blastout delete mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/.chunks.input.fasta delete mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/input.1.fasta delete mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta delete mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta delete mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta delete mode 100644 work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta delete mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.begin delete mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.err delete mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.log delete mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.out delete mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.run delete mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.command.sh delete mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/.exitcode delete mode 100644 work/26/04e3f135871f67b7aa32f7a492afd3/input.blastout delete mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.begin delete mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.err delete mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.log delete mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.out delete mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.run delete mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.command.sh delete mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/.exitcode delete mode 120000 work/3f/a7cae8fdde157089440ff4d2e77089/input.1.fasta delete mode 100644 work/3f/a7cae8fdde157089440ff4d2e77089/input.blastout delete mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.begin delete mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.err delete mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.log delete mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.out delete mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.run delete mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.sh delete mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/.exitcode delete mode 100644 work/71/0d3867a8d3b5de4fe7c5a25071f455/input.blastout delete mode 120000 work/71/0d3867a8d3b5de4fe7c5a25071f455/input.fasta delete mode 100644 work/71/990da57db0c2c80bed5070f36a2644/.chunks.input.fasta delete mode 100644 work/71/990da57db0c2c80bed5070f36a2644/input.1.fasta delete mode 100644 work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta delete mode 100644 work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta delete mode 100644 work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta delete mode 100644 work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta delete mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.begin delete mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.err delete mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.log delete mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.out delete mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.run delete mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.command.sh delete mode 100644 work/7b/a74d9f937053b223d41e8145db2861/.exitcode delete mode 120000 work/7b/a74d9f937053b223d41e8145db2861/input.5.fasta delete mode 100644 work/7b/a74d9f937053b223d41e8145db2861/input.blastout delete mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.begin delete mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.err delete mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.log delete mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.out delete mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.run delete mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.command.sh delete mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/.exitcode delete mode 100644 work/7f/8ee16d3455b4398f550baeec536ea1/input.blastout delete mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.begin delete mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.err delete mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.log delete mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.out delete mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.run delete mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.command.sh delete mode 100644 work/7f/c96665018e757eb6f4c0765d024062/.exitcode delete mode 120000 work/7f/c96665018e757eb6f4c0765d024062/input.5.fasta delete mode 100644 work/7f/c96665018e757eb6f4c0765d024062/input.blastout delete mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.begin delete mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.err delete mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.log delete mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.out delete mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.run delete mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.command.sh delete mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/.exitcode delete mode 120000 work/8b/56e6fed73cb914f7286cd5d981894e/input.4.fasta delete mode 100644 work/8b/56e6fed73cb914f7286cd5d981894e/input.blastout delete mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.begin delete mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.err delete mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.log delete mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.out delete mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.run delete mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.sh delete mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/.exitcode delete mode 120000 work/99/3d8ec7b2376df49e34b8af5f7065e7/input.2.fasta delete mode 100644 work/99/3d8ec7b2376df49e34b8af5f7065e7/input.blastout delete mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.begin delete mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.err delete mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.log delete mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.out delete mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.run delete mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.sh delete mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/.exitcode delete mode 100644 work/ba/95f5736be825ad1c7b0bd16ad91e73/input.blastout delete mode 120000 work/ba/95f5736be825ad1c7b0bd16ad91e73/input.fasta delete mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.begin delete mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.err delete mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.log delete mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.out delete mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.run delete mode 100644 work/c4/47cf90196657efefed5587143e0906/.command.sh delete mode 100644 work/c4/47cf90196657efefed5587143e0906/.exitcode delete mode 120000 work/c4/47cf90196657efefed5587143e0906/input.4.fasta delete mode 100644 work/c4/47cf90196657efefed5587143e0906/input.blastout delete mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.begin delete mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.err delete mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.log delete mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.out delete mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.run delete mode 100644 work/c4/591e87d704c57904782d621fa23dac/.command.sh delete mode 100644 work/c4/591e87d704c57904782d621fa23dac/.exitcode delete mode 100644 work/c4/591e87d704c57904782d621fa23dac/input.blastout delete mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.begin delete mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.err delete mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.log delete mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.out delete mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.run delete mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.command.sh delete mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/.exitcode delete mode 120000 work/c9/0188819dd55c40e3180e3fa3a02541/input.1.fasta delete mode 100644 work/c9/0188819dd55c40e3180e3fa3a02541/input.blastout delete mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.begin delete mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.err delete mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.log delete mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.out delete mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.run delete mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.sh delete mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode delete mode 120000 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.2.fasta delete mode 100644 work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.blastout diff --git a/.nextflow.log b/.nextflow.log deleted file mode 100644 index d1f7b6c..0000000 --- a/.nextflow.log +++ /dev/null @@ -1,55 +0,0 @@ -Feb-23 18:00:50.425 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf -Feb-23 18:00:50.655 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 -Feb-23 18:00:50.680 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [drunk_curran] - revision: d54b25fd7c -Feb-23 18:00:50.844 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 18:00:50.854 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 18:00:51.109 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` -Feb-23 18:00:52.475 [main] DEBUG nextflow.Session - Session uuid: ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8 -Feb-23 18:00:52.476 [main] DEBUG nextflow.Session - Run name: drunk_curran -Feb-23 18:00:52.478 [main] DEBUG nextflow.Session - Executor pool size: 16 -Feb-23 18:00:52.520 [main] DEBUG nextflow.cli.CmdRun - - Version: 20.10.0 build 5430 - Created: 01-11-2020 15:14 UTC (16:14 CEST) - System: Linux 4.19.128-microsoft-standard - Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 - Encoding: UTF-8 (UTF-8) - Process: 3616@LAPTOP-JNRGC094 [127.0.1.1] - CPUs: 16 - Mem: 12 GB (11.1 GB) - Swap: 4 GB (4 GB) -Feb-23 18:00:52.573 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] -Feb-23 18:00:52.574 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin -Feb-23 18:00:52.633 [main] DEBUG nextflow.Session - Observer factory: TowerFactory -Feb-23 18:00:52.637 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory -Feb-23 18:00:53.310 [main] DEBUG nextflow.Session - Session start invoked -Feb-23 18:00:54.123 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution -Feb-23 18:00:54.146 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast -Feb-23 18:00:54.274 [Actor Thread 1] DEBUG n.splitter.AbstractTextSplitter - Splitter `Fasta` collector path: nextflow.splitter.TextFileCollector$CachePath(/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.fasta, null) -Feb-23 18:00:54.341 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null -Feb-23 18:00:54.342 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' -Feb-23 18:00:54.349 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local -Feb-23 18:00:54.357 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m -Feb-23 18:00:54.509 [main] DEBUG nextflow.script.ScriptRunner - > Await termination -Feb-23 18:00:54.510 [main] DEBUG nextflow.Session - Session await -Feb-23 18:00:54.826 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 18:00:54.832 [Task submitter] INFO nextflow.Session - [1d/f4a2c5] Submitted process > runBlast (3) -Feb-23 18:00:54.866 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 18:00:54.867 [Task submitter] INFO nextflow.Session - [f7/f59d4a] Submitted process > runBlast (2) -Feb-23 18:00:54.889 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 18:00:54.891 [Task submitter] INFO nextflow.Session - [7b/a74d9f] Submitted process > runBlast (5) -Feb-23 18:00:54.910 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 18:00:54.911 [Task submitter] INFO nextflow.Session - [3f/a7cae8] Submitted process > runBlast (1) -Feb-23 18:00:54.937 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 18:00:54.939 [Task submitter] INFO nextflow.Session - [c4/47cf90] Submitted process > runBlast (4) -Feb-23 18:00:54.954 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 2; name: runBlast (3); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/1d/f4a2c552cbdfc306b893dd7d2e74b8] -Feb-23 18:00:54.976 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 4; name: runBlast (2); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78] -Feb-23 18:00:55.002 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast (5); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/7b/a74d9f937053b223d41e8145db2861] -Feb-23 18:00:55.009 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 3; name: runBlast (1); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/3f/a7cae8fdde157089440ff4d2e77089] -Feb-23 18:00:55.036 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 5; name: runBlast (4); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/47cf90196657efefed5587143e0906] -Feb-23 18:00:55.042 [main] DEBUG nextflow.Session - Session await > all process finished -Feb-23 18:00:55.101 [Actor Thread 1] DEBUG nextflow.sort.BigSort - Sort completed -- entries: 5; slices: 1; internal sort time: 0.05 s; external sort time: 0.001 s; total time: 0.051 s -Feb-23 18:00:55.135 [Actor Thread 1] DEBUG nextflow.file.FileCollector - Saved collect-files list to: /tmp/205544ad8fa70bcb42fa66aee246028d.collect-file -Feb-23 18:00:55.136 [main] DEBUG nextflow.Session - Session await > all barriers passed -Feb-23 18:00:55.144 [Actor Thread 1] DEBUG nextflow.file.FileCollector - Deleting file collector temp dir: /tmp/nxf-13992828883881010697 -Feb-23 18:00:55.152 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=5; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=242ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=3; peakCpus=3; peakMemory=0; ] -Feb-23 18:00:55.248 [main] DEBUG nextflow.CacheDB - Closing CacheDB done -Feb-23 18:00:55.252 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown -Feb-23 18:00:55.283 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.1 b/.nextflow.log.1 deleted file mode 100644 index e9ac2d5..0000000 --- a/.nextflow.log.1 +++ /dev/null @@ -1,52 +0,0 @@ -Feb-23 17:58:46.370 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf -Feb-23 17:58:46.587 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 -Feb-23 17:58:46.606 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [modest_noether] - revision: 0a507e6896 -Feb-23 17:58:46.645 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 17:58:46.646 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 17:58:46.680 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` -Feb-23 17:58:47.536 [main] DEBUG nextflow.Session - Session uuid: e28879fe-8327-4035-8a19-947fb5ce86d4 -Feb-23 17:58:47.536 [main] DEBUG nextflow.Session - Run name: modest_noether -Feb-23 17:58:47.538 [main] DEBUG nextflow.Session - Executor pool size: 16 -Feb-23 17:58:47.576 [main] DEBUG nextflow.cli.CmdRun - - Version: 20.10.0 build 5430 - Created: 01-11-2020 15:14 UTC (16:14 CEST) - System: Linux 4.19.128-microsoft-standard - Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 - Encoding: UTF-8 (UTF-8) - Process: 3403@LAPTOP-JNRGC094 [127.0.1.1] - CPUs: 16 - Mem: 12 GB (11.1 GB) - Swap: 4 GB (4 GB) -Feb-23 17:58:47.634 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] -Feb-23 17:58:47.636 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin -Feb-23 17:58:47.698 [main] DEBUG nextflow.Session - Observer factory: TowerFactory -Feb-23 17:58:47.701 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory -Feb-23 17:58:47.932 [main] DEBUG nextflow.Session - Session start invoked -Feb-23 17:58:48.351 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution -Feb-23 17:58:48.370 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast -Feb-23 17:58:48.508 [Actor Thread 1] DEBUG n.splitter.AbstractTextSplitter - Splitter `Fasta` collector path: nextflow.splitter.TextFileCollector$CachePath(/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.fasta, null) -Feb-23 17:58:48.580 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null -Feb-23 17:58:48.581 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' -Feb-23 17:58:48.590 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local -Feb-23 17:58:48.613 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m -Feb-23 17:58:48.731 [main] DEBUG nextflow.script.ScriptRunner - > Await termination -Feb-23 17:58:48.732 [main] DEBUG nextflow.Session - Session await -Feb-23 17:58:49.113 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 17:58:49.120 [Task submitter] INFO nextflow.Session - [11/6632f0] Submitted process > runBlast (3) -Feb-23 17:58:49.150 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 17:58:49.151 [Task submitter] INFO nextflow.Session - [99/3d8ec7] Submitted process > runBlast (2) -Feb-23 17:58:49.175 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 17:58:49.176 [Task submitter] INFO nextflow.Session - [8b/56e6fe] Submitted process > runBlast (4) -Feb-23 17:58:49.208 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 17:58:49.210 [Task submitter] INFO nextflow.Session - [c9/018881] Submitted process > runBlast (1) -Feb-23 17:58:49.241 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 2; name: runBlast (3); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc] -Feb-23 17:58:49.245 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 17:58:49.248 [Task submitter] INFO nextflow.Session - [7f/c96665] Submitted process > runBlast (5) -Feb-23 17:58:49.297 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast (2); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/99/3d8ec7b2376df49e34b8af5f7065e7] -Feb-23 17:58:49.327 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 5; name: runBlast (4); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/8b/56e6fed73cb914f7286cd5d981894e] -Feb-23 17:58:49.360 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 4; name: runBlast (1); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/c9/0188819dd55c40e3180e3fa3a02541] -Feb-23 17:58:49.382 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 3; name: runBlast (5); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/c96665018e757eb6f4c0765d024062] -Feb-23 17:58:49.400 [main] DEBUG nextflow.Session - Session await > all process finished -Feb-23 17:58:49.401 [main] DEBUG nextflow.Session - Session await > all barriers passed -Feb-23 17:58:49.407 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=5; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=26ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] -Feb-23 17:58:49.633 [main] DEBUG nextflow.CacheDB - Closing CacheDB done -Feb-23 17:58:49.637 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown -Feb-23 17:58:49.673 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.2 b/.nextflow.log.2 deleted file mode 100644 index 894e827..0000000 --- a/.nextflow.log.2 +++ /dev/null @@ -1,39 +0,0 @@ -Feb-23 17:58:06.133 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf -Feb-23 17:58:06.363 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 -Feb-23 17:58:06.387 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [trusting_pike] - revision: 7228a16b59 -Feb-23 17:58:06.426 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 17:58:06.428 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 17:58:06.461 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` -Feb-23 17:58:07.308 [main] DEBUG nextflow.Session - Session uuid: 7d3f89a6-bccf-443b-bd4a-3a96c7f57638 -Feb-23 17:58:07.308 [main] DEBUG nextflow.Session - Run name: trusting_pike -Feb-23 17:58:07.309 [main] DEBUG nextflow.Session - Executor pool size: 16 -Feb-23 17:58:07.352 [main] DEBUG nextflow.cli.CmdRun - - Version: 20.10.0 build 5430 - Created: 01-11-2020 15:14 UTC (16:14 CEST) - System: Linux 4.19.128-microsoft-standard - Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 - Encoding: UTF-8 (UTF-8) - Process: 3288@LAPTOP-JNRGC094 [127.0.1.1] - CPUs: 16 - Mem: 12 GB (11.2 GB) - Swap: 4 GB (4 GB) -Feb-23 17:58:07.404 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] -Feb-23 17:58:07.405 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin -Feb-23 17:58:07.445 [main] DEBUG nextflow.Session - Observer factory: TowerFactory -Feb-23 17:58:07.450 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory -Feb-23 17:58:07.690 [main] DEBUG nextflow.Session - Session start invoked -Feb-23 17:58:08.132 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution -Feb-23 17:58:08.150 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast -Feb-23 17:58:08.310 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null -Feb-23 17:58:08.311 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' -Feb-23 17:58:08.319 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local -Feb-23 17:58:08.325 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m -Feb-23 17:58:08.437 [main] DEBUG nextflow.script.ScriptRunner - > Await termination -Feb-23 17:58:08.438 [main] DEBUG nextflow.Session - Session await -Feb-23 17:58:08.790 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 17:58:08.801 [Task submitter] INFO nextflow.Session - [ba/95f573] Submitted process > runBlast (1) -Feb-23 17:58:08.904 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast (1); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/ba/95f5736be825ad1c7b0bd16ad91e73] -Feb-23 17:58:08.940 [main] DEBUG nextflow.Session - Session await > all process finished -Feb-23 17:58:08.943 [main] DEBUG nextflow.Session - Session await > all barriers passed -Feb-23 17:58:08.950 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=1; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=60ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] -Feb-23 17:58:09.184 [main] DEBUG nextflow.CacheDB - Closing CacheDB done -Feb-23 17:58:09.189 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown -Feb-23 17:58:09.221 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.3 b/.nextflow.log.3 deleted file mode 100644 index 528c383..0000000 --- a/.nextflow.log.3 +++ /dev/null @@ -1,40 +0,0 @@ -Feb-23 17:57:41.097 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf -Feb-23 17:57:41.284 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 -Feb-23 17:57:41.305 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [special_plateau] - revision: 3dd7a0c300 -Feb-23 17:57:41.338 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 17:57:41.340 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 17:57:41.373 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` -Feb-23 17:57:42.234 [main] DEBUG nextflow.Session - Session uuid: e25eb517-482a-4dc2-8c08-e6575b46df44 -Feb-23 17:57:42.235 [main] DEBUG nextflow.Session - Run name: special_plateau -Feb-23 17:57:42.236 [main] DEBUG nextflow.Session - Executor pool size: 16 -Feb-23 17:57:42.290 [main] DEBUG nextflow.cli.CmdRun - - Version: 20.10.0 build 5430 - Created: 01-11-2020 15:14 UTC (16:14 CEST) - System: Linux 4.19.128-microsoft-standard - Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 - Encoding: UTF-8 (UTF-8) - Process: 3171@LAPTOP-JNRGC094 [127.0.1.1] - CPUs: 16 - Mem: 12 GB (11.1 GB) - Swap: 4 GB (4 GB) -Feb-23 17:57:42.357 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] -Feb-23 17:57:42.358 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin -Feb-23 17:57:42.429 [main] DEBUG nextflow.Session - Observer factory: TowerFactory -Feb-23 17:57:42.432 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory -Feb-23 17:57:42.646 [main] DEBUG nextflow.Session - Session start invoked -Feb-23 17:57:43.062 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution -Feb-23 17:57:43.079 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast -Feb-23 17:57:43.154 [main] WARN nextflow.extension.IntoOp - The `into` operator should be used to connect two or more target channels -- consider to replace it with `.set { queryFile_ch }` -Feb-23 17:57:43.272 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null -Feb-23 17:57:43.273 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' -Feb-23 17:57:43.281 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local -Feb-23 17:57:43.288 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m -Feb-23 17:57:43.394 [main] DEBUG nextflow.script.ScriptRunner - > Await termination -Feb-23 17:57:43.395 [main] DEBUG nextflow.Session - Session await -Feb-23 17:57:43.736 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 17:57:43.744 [Task submitter] INFO nextflow.Session - [71/0d3867] Submitted process > runBlast (1) -Feb-23 17:57:43.858 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast (1); status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/71/0d3867a8d3b5de4fe7c5a25071f455] -Feb-23 17:57:43.892 [main] DEBUG nextflow.Session - Session await > all process finished -Feb-23 17:57:43.895 [main] DEBUG nextflow.Session - Session await > all barriers passed -Feb-23 17:57:43.903 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=1; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=52ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] -Feb-23 17:57:44.134 [main] DEBUG nextflow.CacheDB - Closing CacheDB done -Feb-23 17:57:44.137 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown -Feb-23 17:57:44.169 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.4 b/.nextflow.log.4 deleted file mode 100644 index 76a9f88..0000000 --- a/.nextflow.log.4 +++ /dev/null @@ -1,55 +0,0 @@ -Feb-23 17:57:06.765 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf -Feb-23 17:57:06.974 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 -Feb-23 17:57:06.994 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [pedantic_rubens] - revision: 3bfdc02ef4 -Feb-23 17:57:07.025 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 17:57:07.027 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 17:57:07.062 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` -Feb-23 17:57:07.870 [main] DEBUG nextflow.Session - Session uuid: e38dcb45-706f-4949-9d2c-76fafacf54dd -Feb-23 17:57:07.870 [main] DEBUG nextflow.Session - Run name: pedantic_rubens -Feb-23 17:57:07.871 [main] DEBUG nextflow.Session - Executor pool size: 16 -Feb-23 17:57:07.908 [main] DEBUG nextflow.cli.CmdRun - - Version: 20.10.0 build 5430 - Created: 01-11-2020 15:14 UTC (16:14 CEST) - System: Linux 4.19.128-microsoft-standard - Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 - Encoding: UTF-8 (UTF-8) - Process: 3073@LAPTOP-JNRGC094 [127.0.1.1] - CPUs: 16 - Mem: 12 GB (11.2 GB) - Swap: 4 GB (4 GB) -Feb-23 17:57:07.971 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] -Feb-23 17:57:07.972 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin -Feb-23 17:57:08.016 [main] DEBUG nextflow.Session - Observer factory: TowerFactory -Feb-23 17:57:08.020 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory -Feb-23 17:57:08.252 [main] DEBUG nextflow.Session - Session start invoked -Feb-23 17:57:08.682 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution -Feb-23 17:57:08.702 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast -Feb-23 17:57:08.785 [main] WARN nextflow.extension.IntoOp - The `into` operator should be used to connect two or more target channels -- consider to replace it with `.set { queryFile_ch }` -Feb-23 17:57:08.894 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null -Feb-23 17:57:08.894 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' -Feb-23 17:57:08.901 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local -Feb-23 17:57:08.907 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m -Feb-23 17:57:08.999 [main] DEBUG nextflow.script.ScriptRunner - > Await termination -Feb-23 17:57:09.000 [main] DEBUG nextflow.Session - Session await -Feb-23 17:57:09.111 [Actor Thread 3] ERROR nextflow.processor.TaskProcessor - Error executing process > 'runBlast (1)' - -Caused by: - Unknown variable 'pqueryFile' -- Make sure it is not misspelt and defined somewhere in the script before using it - -Source block: - """ - blastn -num_threads $params.threads -db $params.dbDir/$params.dbName -query $pqueryFile -outfmt $params.outfmt $params.options -out $params.outFileName - """ - -Tip: when you have fixed the problem you can continue the execution adding the option `-resume` to the run command line -Feb-23 17:57:09.119 [Actor Thread 3] DEBUG nextflow.Session - Session aborted -- Cause: Process `null` script contains error(s) -Feb-23 17:57:09.142 [Actor Thread 3] DEBUG nextflow.Session - The following nodes are still active: -[process] runBlast - status=ACTIVE - port 0: (queue) closed; channel: queryFile - port 1: (cntrl) - ; channel: $ - -Feb-23 17:57:09.145 [main] DEBUG nextflow.Session - Session await > all process finished -Feb-23 17:57:09.146 [main] DEBUG nextflow.Session - Session await > all barriers passed -Feb-23 17:57:09.154 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=0; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=0ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=0; peakCpus=0; peakMemory=0; ] -Feb-23 17:57:09.351 [main] DEBUG nextflow.CacheDB - Closing CacheDB done -Feb-23 17:57:09.355 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown -Feb-23 17:57:09.395 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.5 b/.nextflow.log.5 deleted file mode 100644 index a40eb03..0000000 --- a/.nextflow.log.5 +++ /dev/null @@ -1,39 +0,0 @@ -Feb-23 17:50:36.273 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf -Feb-23 17:50:36.476 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 -Feb-23 17:50:36.497 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [reverent_leavitt] - revision: 8c0baa1798 -Feb-23 17:50:36.539 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 17:50:36.541 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 17:50:36.577 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` -Feb-23 17:50:37.466 [main] DEBUG nextflow.Session - Session uuid: ffccacf1-a0d4-4d67-a60d-6d78f86640e8 -Feb-23 17:50:37.466 [main] DEBUG nextflow.Session - Run name: reverent_leavitt -Feb-23 17:50:37.467 [main] DEBUG nextflow.Session - Executor pool size: 16 -Feb-23 17:50:37.514 [main] DEBUG nextflow.cli.CmdRun - - Version: 20.10.0 build 5430 - Created: 01-11-2020 15:14 UTC (16:14 CEST) - System: Linux 4.19.128-microsoft-standard - Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 - Encoding: UTF-8 (UTF-8) - Process: 2952@LAPTOP-JNRGC094 [127.0.1.1] - CPUs: 16 - Mem: 12 GB (11.2 GB) - Swap: 4 GB (4 GB) -Feb-23 17:50:37.576 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] -Feb-23 17:50:37.578 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin -Feb-23 17:50:37.640 [main] DEBUG nextflow.Session - Observer factory: TowerFactory -Feb-23 17:50:37.644 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory -Feb-23 17:50:37.893 [main] DEBUG nextflow.Session - Session start invoked -Feb-23 17:50:38.274 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution -Feb-23 17:50:38.295 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast -Feb-23 17:50:38.394 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null -Feb-23 17:50:38.395 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' -Feb-23 17:50:38.404 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local -Feb-23 17:50:38.417 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m -Feb-23 17:50:38.577 [main] DEBUG nextflow.script.ScriptRunner - > Await termination -Feb-23 17:50:38.578 [main] DEBUG nextflow.Session - Session await -Feb-23 17:50:38.959 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 17:50:38.966 [Task submitter] INFO nextflow.Session - [c4/591e87] Submitted process > runBlast -Feb-23 17:50:39.239 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast; status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/591e87d704c57904782d621fa23dac] -Feb-23 17:50:39.275 [main] DEBUG nextflow.Session - Session await > all process finished -Feb-23 17:50:39.278 [main] DEBUG nextflow.Session - Session await > all barriers passed -Feb-23 17:50:39.286 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=1; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=191ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] -Feb-23 17:50:39.397 [main] DEBUG nextflow.CacheDB - Closing CacheDB done -Feb-23 17:50:39.403 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown -Feb-23 17:50:39.433 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.6 b/.nextflow.log.6 deleted file mode 100644 index 7686adb..0000000 --- a/.nextflow.log.6 +++ /dev/null @@ -1,39 +0,0 @@ -Feb-23 10:59:48.511 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf -Feb-23 10:59:48.682 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 -Feb-23 10:59:48.701 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [loving_gautier] - revision: 90b303acac -Feb-23 10:59:48.741 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 10:59:48.743 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 10:59:48.780 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` -Feb-23 10:59:49.647 [main] DEBUG nextflow.Session - Session uuid: 6cc9b687-9f88-4abd-b1c2-34d13dedccaa -Feb-23 10:59:49.648 [main] DEBUG nextflow.Session - Run name: loving_gautier -Feb-23 10:59:49.651 [main] DEBUG nextflow.Session - Executor pool size: 16 -Feb-23 10:59:49.693 [main] DEBUG nextflow.cli.CmdRun - - Version: 20.10.0 build 5430 - Created: 01-11-2020 15:14 UTC (16:14 CEST) - System: Linux 4.19.128-microsoft-standard - Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 - Encoding: UTF-8 (UTF-8) - Process: 2837@LAPTOP-JNRGC094 [127.0.1.1] - CPUs: 16 - Mem: 12 GB (11.1 GB) - Swap: 4 GB (4 GB) -Feb-23 10:59:49.749 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] -Feb-23 10:59:49.750 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin -Feb-23 10:59:49.795 [main] DEBUG nextflow.Session - Observer factory: TowerFactory -Feb-23 10:59:49.799 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory -Feb-23 10:59:50.014 [main] DEBUG nextflow.Session - Session start invoked -Feb-23 10:59:50.310 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution -Feb-23 10:59:50.328 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast -Feb-23 10:59:50.389 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null -Feb-23 10:59:50.390 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' -Feb-23 10:59:50.399 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local -Feb-23 10:59:50.408 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m -Feb-23 10:59:50.601 [main] DEBUG nextflow.script.ScriptRunner - > Await termination -Feb-23 10:59:50.602 [main] DEBUG nextflow.Session - Session await -Feb-23 10:59:50.899 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 10:59:50.907 [Task submitter] INFO nextflow.Session - [26/04e3f1] Submitted process > runBlast -Feb-23 10:59:50.998 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast; status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/26/04e3f135871f67b7aa32f7a492afd3] -Feb-23 10:59:51.020 [main] DEBUG nextflow.Session - Session await > all process finished -Feb-23 10:59:51.022 [main] DEBUG nextflow.Session - Session await > all barriers passed -Feb-23 10:59:51.031 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=1; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=60ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] -Feb-23 10:59:51.155 [main] DEBUG nextflow.CacheDB - Closing CacheDB done -Feb-23 10:59:51.159 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown -Feb-23 10:59:51.186 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.7 b/.nextflow.log.7 deleted file mode 100644 index fcf8a85..0000000 --- a/.nextflow.log.7 +++ /dev/null @@ -1,39 +0,0 @@ -Feb-23 10:58:01.567 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf -Feb-23 10:58:01.727 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 -Feb-23 10:58:01.749 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [fabulous_fermat] - revision: 6593265ff7 -Feb-23 10:58:01.784 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 10:58:01.786 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 10:58:01.821 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` -Feb-23 10:58:02.660 [main] DEBUG nextflow.Session - Session uuid: 82425c5e-2c2c-408c-b892-c2f085aed751 -Feb-23 10:58:02.661 [main] DEBUG nextflow.Session - Run name: fabulous_fermat -Feb-23 10:58:02.663 [main] DEBUG nextflow.Session - Executor pool size: 16 -Feb-23 10:58:02.707 [main] DEBUG nextflow.cli.CmdRun - - Version: 20.10.0 build 5430 - Created: 01-11-2020 15:14 UTC (16:14 CEST) - System: Linux 4.19.128-microsoft-standard - Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 - Encoding: UTF-8 (UTF-8) - Process: 2718@LAPTOP-JNRGC094 [127.0.1.1] - CPUs: 16 - Mem: 12 GB (11.1 GB) - Swap: 4 GB (4 GB) -Feb-23 10:58:02.755 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] -Feb-23 10:58:02.756 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin -Feb-23 10:58:02.802 [main] DEBUG nextflow.Session - Observer factory: TowerFactory -Feb-23 10:58:02.807 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory -Feb-23 10:58:03.046 [main] DEBUG nextflow.Session - Session start invoked -Feb-23 10:58:03.321 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution -Feb-23 10:58:03.339 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: runBlast -Feb-23 10:58:03.389 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null -Feb-23 10:58:03.390 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local' -Feb-23 10:58:03.397 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local -Feb-23 10:58:03.405 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=16; memory=12 GB; capacity=16; pollInterval=100ms; dumpInterval=5m -Feb-23 10:58:03.553 [main] DEBUG nextflow.script.ScriptRunner - > Await termination -Feb-23 10:58:03.554 [main] DEBUG nextflow.Session - Session await -Feb-23 10:58:03.766 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run -Feb-23 10:58:03.774 [Task submitter] INFO nextflow.Session - [7f/8ee16d] Submitted process > runBlast -Feb-23 10:58:03.869 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: runBlast; status: COMPLETED; exit: 0; error: -; workDir: /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/8ee16d3455b4398f550baeec536ea1] -Feb-23 10:58:03.888 [main] DEBUG nextflow.Session - Session await > all process finished -Feb-23 10:58:03.891 [main] DEBUG nextflow.Session - Session await > all barriers passed -Feb-23 10:58:03.901 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=1; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=36ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ] -Feb-23 10:58:04.129 [main] DEBUG nextflow.CacheDB - Closing CacheDB done -Feb-23 10:58:04.132 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown -Feb-23 10:58:04.162 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.8 b/.nextflow.log.8 deleted file mode 100644 index 331291a..0000000 --- a/.nextflow.log.8 +++ /dev/null @@ -1,32 +0,0 @@ -Feb-23 10:55:04.031 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf -Feb-23 10:55:04.251 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 -Feb-23 10:55:04.278 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [marvelous_kare] - revision: 17ee5c59e3 -Feb-23 10:55:04.316 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 10:55:04.319 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 10:55:04.353 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` -Feb-23 10:55:05.241 [main] DEBUG nextflow.Session - Session uuid: 44a9c761-7c53-4e93-985b-3efc6907178e -Feb-23 10:55:05.241 [main] DEBUG nextflow.Session - Run name: marvelous_kare -Feb-23 10:55:05.243 [main] DEBUG nextflow.Session - Executor pool size: 16 -Feb-23 10:55:05.286 [main] DEBUG nextflow.cli.CmdRun - - Version: 20.10.0 build 5430 - Created: 01-11-2020 15:14 UTC (16:14 CEST) - System: Linux 4.19.128-microsoft-standard - Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 - Encoding: UTF-8 (UTF-8) - Process: 2313@LAPTOP-JNRGC094 [127.0.1.1] - CPUs: 16 - Mem: 12 GB (11.2 GB) - Swap: 4 GB (4 GB) -Feb-23 10:55:05.339 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] -Feb-23 10:55:05.340 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin -Feb-23 10:55:05.396 [main] DEBUG nextflow.Session - Observer factory: TowerFactory -Feb-23 10:55:05.399 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory -Feb-23 10:55:05.592 [main] DEBUG nextflow.Session - Session start invoked -Feb-23 10:55:05.744 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution -Feb-23 10:55:05.763 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: -Feb-23 10:55:05.768 [main] DEBUG nextflow.script.ScriptRunner - > Await termination -Feb-23 10:55:05.769 [main] DEBUG nextflow.Session - Session await -Feb-23 10:55:05.770 [main] DEBUG nextflow.Session - Session await > all process finished -Feb-23 10:55:05.770 [main] DEBUG nextflow.Session - Session await > all barriers passed -Feb-23 10:55:05.790 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=0; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=0ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=0; peakCpus=0; peakMemory=0; ] -Feb-23 10:55:05.839 [main] DEBUG nextflow.CacheDB - Closing CacheDB done -Feb-23 10:55:05.842 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown -Feb-23 10:55:05.877 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow.log.9 b/.nextflow.log.9 deleted file mode 100644 index 7443694..0000000 --- a/.nextflow.log.9 +++ /dev/null @@ -1,32 +0,0 @@ -Feb-23 10:34:39.942 [main] DEBUG nextflow.cli.Launcher - $> nextflow run main.nf -Feb-23 10:34:40.130 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 -Feb-23 10:34:40.162 [main] INFO nextflow.cli.CmdRun - Launching `main.nf` [tiny_saha] - revision: 0e6d4aa3ec -Feb-23 10:34:40.211 [main] DEBUG nextflow.config.ConfigBuilder - Found config local: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 10:34:40.213 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /mnt/d/Work/nextflow_stuff/nftutorial/nextflow.config -Feb-23 10:34:40.254 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` -Feb-23 10:34:41.154 [main] DEBUG nextflow.Session - Session uuid: a33372da-190e-4d40-a449-71e610806fc2 -Feb-23 10:34:41.154 [main] DEBUG nextflow.Session - Run name: tiny_saha -Feb-23 10:34:41.156 [main] DEBUG nextflow.Session - Executor pool size: 16 -Feb-23 10:34:41.205 [main] DEBUG nextflow.cli.CmdRun - - Version: 20.10.0 build 5430 - Created: 01-11-2020 15:14 UTC (16:14 CEST) - System: Linux 4.19.128-microsoft-standard - Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 14.0.2+12-Ubuntu-120.04 - Encoding: UTF-8 (UTF-8) - Process: 2092@LAPTOP-JNRGC094 [127.0.1.1] - CPUs: 16 - Mem: 12 GB (11.2 GB) - Swap: 4 GB (4 GB) -Feb-23 10:34:41.311 [main] DEBUG nextflow.Session - Work-dir: /mnt/d/Work/nextflow_stuff/nftutorial/work [v9fs] -Feb-23 10:34:41.312 [main] DEBUG nextflow.Session - Script base path does not exist or is not a directory: /mnt/d/Work/nextflow_stuff/nftutorial/bin -Feb-23 10:34:41.382 [main] DEBUG nextflow.Session - Observer factory: TowerFactory -Feb-23 10:34:41.388 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory -Feb-23 10:34:41.737 [main] DEBUG nextflow.Session - Session start invoked -Feb-23 10:34:42.125 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution -Feb-23 10:34:42.157 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: -Feb-23 10:34:42.166 [main] DEBUG nextflow.script.ScriptRunner - > Await termination -Feb-23 10:34:42.167 [main] DEBUG nextflow.Session - Session await -Feb-23 10:34:42.168 [main] DEBUG nextflow.Session - Session await > all process finished -Feb-23 10:34:42.168 [main] DEBUG nextflow.Session - Session await > all barriers passed -Feb-23 10:34:42.198 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=0; failedCount=0; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=0ms; failedDuration=0ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=0; peakCpus=0; peakMemory=0; ] -Feb-23 10:34:42.419 [main] DEBUG nextflow.CacheDB - Closing CacheDB done -Feb-23 10:34:42.427 [main] DEBUG nextflow.util.SpuriousDeps - AWS S3 uploader shutdown -Feb-23 10:34:42.524 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye diff --git a/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/000003.log b/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/000003.log deleted file mode 100644 index e69de29..0000000 diff --git a/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/CURRENT b/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/CURRENT deleted file mode 100644 index 1a84852..0000000 --- a/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/CURRENT +++ /dev/null @@ -1 +0,0 @@ -MANIFEST-000002 diff --git a/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/LOCK b/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/LOCK deleted file mode 100644 index e69de29..0000000 diff --git a/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/MANIFEST-000002 b/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/db/MANIFEST-000002 deleted file mode 100644 index bbbc585686bcbcc33686059c69d80b7b4e1291cd..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 50 zcmWIhx#Ncn10$nUPHI_dPD+xVQ)NkNd1i5{bAE0?Vo_pAe$kRS-TOEg7@3$k8JJmE F7y#sj5K{mE diff --git a/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/index.marvelous_kare b/.nextflow/cache/44a9c761-7c53-4e93-985b-3efc6907178e/index.marvelous_kare deleted file mode 100644 index e69de29..0000000 diff --git a/.nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/000003.log b/.nextflow/cache/6cc9b687-9f88-4abd-b1c2-34d13dedccaa/db/000003.log deleted file mode 100644 index 404fe11ca871fd7670ab416ca2fb08f225c1332b..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 704 zcma)4F>ezw6wW)B;W{z1a06mXj$YaXM$$$CDHRNr7!Zn_J0CGQ+lT$!roVu_8w(RH zhy^hrR>aE0PoRMcBm~W=kPSOg1Y;J~jVG5M zzI~Paetz)!)6)x3dqj6>!y+#lH?^kwJ#H!>0QcX+Y~_En$K{A+x2PFz)1PpO08%sR z^J4(X#+VmsuTg51GGml(>^SW9F$4q*QnXV7n|HSF_PRUW4+MtPoDfJ_@wIi<%-;}@ zR7?nHD?0@>6#+KpRZw$WI}p4I&kheKvj_7~x(bhu7TzM+l&pFsU)^h=GFwa__*c-T zDhie&SJGVRiV~N_rAi{@lASshMP#C^0xvbyymaZm1*=gsa8gi4QC(Wm$Dw94Gf@)N zvq2OKiE$R+Q+gCHYwsJhc^=CgEh^1v5pQ+kcphY{6V)GEruWZDHw#5E}CL`;wss5dNO`W;3J$*p(n)4Z&+(?TyL-Ct@fZzX*0>&bp1v` z^Q=k0iMJD%AT90G_en6J^vqpk+d9Cau5B002kG2!j9s diff --git a/.nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/000003.log b/.nextflow/cache/7d3f89a6-bccf-443b-bd4a-3a96c7f57638/db/000003.log deleted file mode 100644 index 6bade72b6d10541d8824712858c4982270b9e95d..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 693 zcma)4J!}&(7|nMF!@BJd$am*c+??&Jf6`Pez`)pz z5s8%n7B(h?5E}zxs#qHlfmEUPKmoiu_G54Ju(zxO>q`^)pKy;mMUZ9d!z=iWU1 zsfN?bFE2be`)PCUqS`$TwM{(2b)#ufzab^w=}}dI4{+}t9Gv-Yzp z_d#Pd?9+V!PR2Sf#CE-uA|*-*S>LeOt$px(P#SA<J z(e>O4V-yObbEeT!YYBy9gbPDZOv1(tI5|0^+jG{=%pKP0)LP!QjWc@a!$E5rJ2|UX=#pJAdD~}kL^ZA)pxsS${bAiFE>jm wWFNbD4{VtVRu)80f+vsX@01yd9Tt4BU(3cFFwoW z?)&wZyH}2WJXCKFFGKAq+hdVKkw(nJo$M15pMw&vgSS%J9#t!|C~xc_>qcUtTY~MY0)Lsg!*6ucc01K84_4 zK^r>Hd4fVKd%Y_QTo#vTg-j@Z=2;Ap%c2Y_sfiJVPya1gp>*J-prW*{ob2P!aF$wn zo7U3-jitgkjUQ<^MMffXTM{zBSlwpxQ`V|^`awQda<=Si#4 z=4_RK7w@J%K~lI`)h5ZMHs}5#752L~C}ah5^{d*A(WcL;rvLPAqGgeDoQ6kl7QdD{ e!zwI%=ZDNUHLuv=Ry6}C_PC#?@bqRa2>t?lVD{$# diff --git a/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/CURRENT b/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/CURRENT deleted file mode 100644 index 1a84852..0000000 --- a/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/CURRENT +++ /dev/null @@ -1 +0,0 @@ -MANIFEST-000002 diff --git a/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/LOCK b/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/LOCK deleted file mode 100644 index e69de29..0000000 diff --git a/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/MANIFEST-000002 b/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/db/MANIFEST-000002 deleted file mode 100644 index bbbc585686bcbcc33686059c69d80b7b4e1291cd..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 50 zcmWIhx#Ncn10$nUPHI_dPD+xVQ)NkNd1i5{bAE0?Vo_pAe$kRS-TOEg7@3$k8JJmE F7y#sj5K{mE diff --git a/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/index.fabulous_fermat b/.nextflow/cache/82425c5e-2c2c-408c-b892-c2f085aed751/index.fabulous_fermat deleted file mode 100644 index a4ea29821b6cfa29560dcc1b366831d0348395ed..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 17 Ycmb>Ldzfnyy2Y|TlzZKq;Jk$l07;(*y#N3J diff --git a/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/000003.log b/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/000003.log deleted file mode 100644 index e69de29..0000000 diff --git a/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/CURRENT b/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/CURRENT deleted file mode 100644 index 1a84852..0000000 --- a/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/CURRENT +++ /dev/null @@ -1 +0,0 @@ -MANIFEST-000002 diff --git a/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/LOCK b/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/LOCK deleted file mode 100644 index e69de29..0000000 diff --git a/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/MANIFEST-000002 b/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/db/MANIFEST-000002 deleted file mode 100644 index bbbc585686bcbcc33686059c69d80b7b4e1291cd..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 50 zcmWIhx#Ncn10$nUPHI_dPD+xVQ)NkNd1i5{bAE0?Vo_pAe$kRS-TOEg7@3$k8JJmE F7y#sj5K{mE diff --git a/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/index.tiny_saha b/.nextflow/cache/a33372da-190e-4d40-a449-71e610806fc2/index.tiny_saha deleted file mode 100644 index e69de29..0000000 diff --git a/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/000003.log b/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/000003.log deleted file mode 100644 index 51d0e0bdbb24e1a598b5da448831fe5c8961b8ab..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 3477 zcmdtkO=uKX902gVnIv?*vX+O{_~$7|Jk7n=J*K?fTr>%J%U$WFAiP!=*Ju9TSxX^`#eWS_O*bfZLlBa66(0Q z_o4{y=yKvB-~re&27Yg@o$Ye`K8)Unac?(#0AA$*g>hexGXa2)2Pkoa?YS@tY#hfy zl-tDSK9~T_Jcucz$t(}neb~LRt8-K5I1hSZJk0|ci9~~neToM@^d@-_C4RdLV=Ams zzvTfQaEe?LTc22-Q_S2PI`R0?)>62rm^pW(JSuO_-rTyt zb+JvIz>imTdLgaes2%teIzE2LRzXU!7Zy2=?PEty$iiLamI;EDrsWGl)=#`1+8ber zVnGqI$Pz@)ry>$J2T`9`twT>t6GB9v(1Zq&16{GBT@*_}I@*QoX9Pb)o3766Wdom`@5c;MX7KGMj%)j& zMPhEbI=6rQacIM~-(I^kJoDw5)4O&KEVSE~O3?n>Eipu*7m#+V(XGt%zQrB(|EETr$VzI4O-y{fO zSvMrJplK2zTKX>`9nBNl(P!C?)v{e%%l2N%cIqrS!q~Rdu^nIk^WaLd`TqU8pX^@# zPNsFC*)E%dt*wcgVUxmeBU`PJ?di(frrd46S}JU{#bR5nz9bj&dELN-eUYx4hODVr VDoFWxV*B@;Y(K4Kd$5hM{RbO)zD)oC diff --git a/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/CURRENT b/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/CURRENT deleted file mode 100644 index 1a84852..0000000 --- a/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/CURRENT +++ /dev/null @@ -1 +0,0 @@ -MANIFEST-000002 diff --git a/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/LOCK b/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/LOCK deleted file mode 100644 index e69de29..0000000 diff --git a/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/MANIFEST-000002 b/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/db/MANIFEST-000002 deleted file mode 100644 index bbbc585686bcbcc33686059c69d80b7b4e1291cd..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 50 zcmWIhx#Ncn10$nUPHI_dPD+xVQ)NkNd1i5{bAE0?Vo_pAe$kRS-TOEg7@3$k8JJmE F7y#sj5K{mE diff --git a/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/index.drunk_curran b/.nextflow/cache/ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8/index.drunk_curran deleted file mode 100644 index f8177ae8d817d9a88414bb250b896e9efe52fd48..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 85 zcmV-b0IL5T^rFR5%iqHWxRc#|E_Ap6_w}7hYU3Qxuy0}5A@RKaESoKN6(NMW>@d;?Nx^qJ_!Z@!aOT% diff --git a/.nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/000003.log b/.nextflow/cache/e25eb517-482a-4dc2-8c08-e6575b46df44/db/000003.log deleted file mode 100644 index 6ab8989fffd9af638f4edb81091b6d1d1996e98c..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 693 zcma)4J!}&(7|nNv;gFD+nLHqs<#J8aG+9X-sYt2Xp%nu{k#pxGCTIKNpS0bX5i2Vb zENqA!!N}ANA*M#Hgj7L#LKF#voiu_G54Ju(zxO>qd++Ht@hSkQ%!gm$#^`$M;ftf! zpSMrmKi?UZdrz)HUH-cgDic9|{#0o;EJXIK73yG#sex=Hk4i+qKf2n^A~ z9ybgZ>_yS zAPAozP*${aq7A-Xdx?M^urjDPzU^~XhQEJ2`*rbPCa219dNHr&4W0TWxAd+~9E;1; z<`W41UT$6HIZX_cLf`7}!YnSDNMQ&Qbm~~d7|M$>@U|1h3MY3IT*J8UZ3&DcVR_FC z6eX#~D>zE~IOf8{X?#zrVZ6wpr;W|BSY*Z;sTj%QjdmQ*L^j$u8d<6iF%yL~)yxSK z97$_3Zt&9D5{~GYK~@^e&04nFXdrMd?Zh=m3VZGY;gm~t;WkpHzqrLP?qMpv`&lWedc?6n+V1002%i2-5%n diff --git a/.nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/000003.log b/.nextflow/cache/e28879fe-8327-4035-8a19-947fb5ce86d4/db/000003.log deleted file mode 100644 index fbd43390ba4a72ee4e7278c397e8d6103a60b0d2..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 3475 zcmdtkPiPcZ7y$6RnJBJ@YQcl_G>4XW*`1yLGti<&11-e12WbzjEN|w$N5;&b?aZ51 zFBPSSmKLi}P!A1l?V$~YrUm;4s)!V-LJvIz6+E?W4K0+QgBnrkH=Ergo5kQEA&@=H z?(CcQy>Gtv{r!5bB%#6yIp`vrL^n@yGRZ_s>P2JRBeX<@h?(w;wlfCF6cj z*_kBx(6FE8NJQwZi)gxk;png*jZ*S5PDl3OY4n_kI8H}v{!N4;dXTdqK2WJAu}9N1 zPAYq0?3J6SUqmU#Ji8;JU9atVeRyc^(61sI!ReHU6h$^oO=S}zig4HzQIbW20ZzHJ zP5W9z^q`*$eK0?BLq9K_zx(;4nSHHrNnSd2fA(&6L5SX-n-^K#f>~iqvY?5C`Ip-j z2LbiCA4lo)Lt&kFUet>tj{S(qKT2W7bxWcQ#{ekY^JA<2*G8Lwy+ z2BEQ3jx)|eE)AFiQkgbzkWopYWvw;Pezp|=o`Zy1`C;x&LDC0cY2x1&(eLQ#k|`$0 zo$6N|g($>v3A0^dQb%VV#=7TvB7!`#CM@99vpYpeLK?=&4E#a-^k4Ymepn3C=x%XM zk~pd1qQL*btrv&&fbwSPtM*QjEWyQC=^wxa1q_PWrOn0ObH72sQR#-+CkW2TO@9Jg zp^NS5myZ4Ry%pwT`cL21>h#u1vn}@jNo*ZQ)`(5LAA8xVy=)(Mu^pRPBW%^xV%w>{ z<*J%x5~e#;(_I@ggIQJ6pw=?6{i3~7b8No^6LV~#tzU8wx9Xz zg`F$ScEb{EJx8u8wrzjc%U0=Sn|HB&@4*`Bw#sU;?NncJ2r&##uTo91;li+ntE!+Kjar0`-C0tO0!+R1Y3*A zo@1Kk*KDy>68Js!Y59nLUojvNvt?o;0|xUvOpT0E<@U{?|OY6!$1> r)!BiGP5{XPh=HBeTtMR(4nL!yB|!jx$!28%j&**v^uTsq0zhH_sRb%N diff --git a/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/000003.log b/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/000003.log deleted file mode 100644 index e69de29..0000000 diff --git a/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/CURRENT b/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/CURRENT deleted file mode 100644 index 1a84852..0000000 --- a/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/CURRENT +++ /dev/null @@ -1 +0,0 @@ -MANIFEST-000002 diff --git a/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/LOCK b/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/LOCK deleted file mode 100644 index e69de29..0000000 diff --git a/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/MANIFEST-000002 b/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/db/MANIFEST-000002 deleted file mode 100644 index bbbc585686bcbcc33686059c69d80b7b4e1291cd..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 50 zcmWIhx#Ncn10$nUPHI_dPD+xVQ)NkNd1i5{bAE0?Vo_pAe$kRS-TOEg7@3$k8JJmE F7y#sj5K{mE diff --git a/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/index.pedantic_rubens b/.nextflow/cache/e38dcb45-706f-4949-9d2c-76fafacf54dd/index.pedantic_rubens deleted file mode 100644 index e69de29..0000000 diff --git a/.nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/000003.log b/.nextflow/cache/ffccacf1-a0d4-4d67-a60d-6d78f86640e8/db/000003.log deleted file mode 100644 index 4fb2969346d4954a7a28c8326bf0a9f69ab9de42..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 720 zcma)4&ubGw7|pj658IPx4>|{-r_DA$+O!7`rVUs~)k8s4N|@}8QzG8>VC-<*D z`CNWKE{}rVwO2RZyuJjbM`TDU*08j4Qz`6hP3CNm6-K$&`$!)>2jW9kzQ49s+HMu~P)wclPdf+WYMj1bw2<5JZh|eXB}0 z-y#r%PY@_8S}D;v0y<*3S8`n2<1F{TKl}1~b}(J_qokaxUWPoauQ6Vxlt_?8w=R**Stwa52LLAzV(S88_D& z(Ry=htSDc63TI7kBHJ|#06?+^kpKVy diff --git a/.nextflow/history b/.nextflow/history deleted file mode 100644 index a20c419..0000000 --- a/.nextflow/history +++ /dev/null @@ -1,10 +0,0 @@ -2021-02-23 10:34:41 1.4s tiny_saha OK 0e6d4aa3ece9f4af1bef44a544b32c03 a33372da-190e-4d40-a449-71e610806fc2 nextflow run main.nf -2021-02-23 10:55:05 850ms marvelous_kare OK 17ee5c59e3ecb963d93db304071b6f52 44a9c761-7c53-4e93-985b-3efc6907178e nextflow run main.nf -2021-02-23 10:58:02 2.1s fabulous_fermat OK 6593265ff7966308764153332014de1a 82425c5e-2c2c-408c-b892-c2f085aed751 nextflow run main.nf -2021-02-23 10:59:49 2.2s loving_gautier OK 90b303acac3eaf67d60804459112c000 6cc9b687-9f88-4abd-b1c2-34d13dedccaa nextflow run main.nf -2021-02-23 17:50:37 2.4s reverent_leavitt OK 8c0baa17989a28a9835bca03ecc025f2 ffccacf1-a0d4-4d67-a60d-6d78f86640e8 nextflow run main.nf -2021-02-23 17:57:07 2.4s pedantic_rubens ERR 3bfdc02ef42ae7cf971c669d297383e3 e38dcb45-706f-4949-9d2c-76fafacf54dd nextflow run main.nf -2021-02-23 17:57:42 2.1s special_plateau OK 3dd7a0c300b3f395e581795ead49d352 e25eb517-482a-4dc2-8c08-e6575b46df44 nextflow run main.nf -2021-02-23 17:58:07 2.2s trusting_pike OK 7228a16b595e1e688ad63480da1bdd3f 7d3f89a6-bccf-443b-bd4a-3a96c7f57638 nextflow run main.nf -2021-02-23 17:58:47 2.6s modest_noether OK 0a507e6896a0681ea9647fb7cd6c381a e28879fe-8327-4035-8a19-947fb5ce86d4 nextflow run main.nf -2021-02-23 18:00:52 3.3s drunk_curran OK d54b25fd7c49e69b8ed322c953ea6b0a ddcf53eb-de5e-4b16-aa90-554cfc3fd7d8 nextflow run main.nf diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.begin b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.err b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.log b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.out b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.run b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.run deleted file mode 100644 index ea8fcf1..0000000 --- a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (3) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.3.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta input.3.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.sh b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.sh deleted file mode 100644 index 3ff5a9f..0000000 --- a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.3.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.3.fasta b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.3.fasta deleted file mode 120000 index 49c43da..0000000 --- a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.3.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta \ No newline at end of file diff --git a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.blastout b/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.blastout deleted file mode 100644 index 9ff0e96..0000000 --- a/work/11/6632f091d1d9bdf8bd6e94fcaa4cbc/input.blastout +++ /dev/null @@ -1 +0,0 @@ -Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.begin b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.err b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.log b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.out b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.run b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.run deleted file mode 100644 index 3dc5390..0000000 --- a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (3) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.3.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta input.3.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.sh b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.sh deleted file mode 100644 index 3ff5a9f..0000000 --- a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.3.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.exitcode b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.3.fasta b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.3.fasta deleted file mode 120000 index 419cf6b..0000000 --- a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.3.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta \ No newline at end of file diff --git a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.blastout b/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.blastout deleted file mode 100644 index 9ff0e96..0000000 --- a/work/1d/f4a2c552cbdfc306b893dd7d2e74b8/input.blastout +++ /dev/null @@ -1 +0,0 @@ -Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/20/a023d9c641eb2e9b732797e1a39b21/.chunks.input.fasta b/work/20/a023d9c641eb2e9b732797e1a39b21/.chunks.input.fasta deleted file mode 100644 index 64abc0829295672ed9460c199708029c26c32dc2..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 513 zcmcJ|u?+$t6aY{u+`u{b2b>a0dwWas@gPAFF7WYmR%Scaffold_1_1..100 -CAGGCAAAATGTGGCACAAAAACAACAAATTGTTTAGTAGATACAGGGGCATCCATTTGTTGTATTTCGTCTGCTTTTCTGAGCACAGCTTTTGAAAACC diff --git a/work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta b/work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta deleted file mode 100644 index e459aa6..0000000 --- a/work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta +++ /dev/null @@ -1,2 +0,0 @@ ->Scaffold_1_101..200 -TTACTCTTGGAAACTCACCCTTTCCACAGGTAAAAGGTGTTGGCGGCGAATTGCATAAAGTGTTAGGTTCAGTTGTGTTAGATTTTGTCATTGAGGATCA diff --git a/work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta b/work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta deleted file mode 100644 index b8b2c14..0000000 --- a/work/20/a023d9c641eb2e9b732797e1a39b21/input.3.fasta +++ /dev/null @@ -1,2 +0,0 @@ ->Scaffold_1_201..300 -GGAATTTTCTCAAAGATTCTATGTACTGCCTACACTGCCGAAGGCAGTGATACTAGGTGAGAACTTCCTTAATGACAATGATGCAGTCTTAGATTATAGC diff --git a/work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta b/work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta deleted file mode 100644 index 732f920..0000000 --- a/work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta +++ /dev/null @@ -1,2 +0,0 @@ ->Scaffold_1_301..400 -TGTCATTCCTTGATACTCAACAACAGCACCTCAGATAGGCAATATATCAATTTCATAGCCAATTCAGTGCATGAGATTAGTGGATTAGCAAAAACACTAG diff --git a/work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta b/work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta deleted file mode 100644 index 2991afa..0000000 --- a/work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta +++ /dev/null @@ -1,2 +0,0 @@ ->Scaffold_1_401..500 -ATCAGATTTACATCCCCCCTCAGAGTGAAATTCATTTCAAGGTCAGACTATCAGAGACCAAAGAGGATTCCCTCATCCTCATTGAACCCATTGCTTCCCT diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.begin b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.err b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.log b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.out b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.run b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.run deleted file mode 100644 index 0d4a3b0..0000000 --- a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.run +++ /dev/null @@ -1,103 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/26/04e3f135871f67b7aa32f7a492afd3/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/26/04e3f135871f67b7aa32f7a492afd3/.command.sh -} - -nxf_stage() { - true -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/26/04e3f135871f67b7aa32f7a492afd3/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.sh b/work/26/04e3f135871f67b7aa32f7a492afd3/.command.sh deleted file mode 100644 index 3e62c00..0000000 --- a/work/26/04e3f135871f67b7aa32f7a492afd3/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query /mnt/d/Work/nextflow_stuff/nftutorial/input.fasta -outfmt 6 -out input.blastout diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/.exitcode b/work/26/04e3f135871f67b7aa32f7a492afd3/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/26/04e3f135871f67b7aa32f7a492afd3/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/26/04e3f135871f67b7aa32f7a492afd3/input.blastout b/work/26/04e3f135871f67b7aa32f7a492afd3/input.blastout deleted file mode 100644 index 8cab1da..0000000 --- a/work/26/04e3f135871f67b7aa32f7a492afd3/input.blastout +++ /dev/null @@ -1,5 +0,0 @@ -Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.begin b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.err b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.log b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.out b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.run b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.run deleted file mode 100644 index fa1d05f..0000000 --- a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (1) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/3f/a7cae8fdde157089440ff4d2e77089/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/3f/a7cae8fdde157089440ff4d2e77089/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.1.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.1.fasta input.1.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/3f/a7cae8fdde157089440ff4d2e77089/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.sh b/work/3f/a7cae8fdde157089440ff4d2e77089/.command.sh deleted file mode 100644 index ef144d5..0000000 --- a/work/3f/a7cae8fdde157089440ff4d2e77089/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.1.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/.exitcode b/work/3f/a7cae8fdde157089440ff4d2e77089/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/3f/a7cae8fdde157089440ff4d2e77089/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/input.1.fasta b/work/3f/a7cae8fdde157089440ff4d2e77089/input.1.fasta deleted file mode 120000 index f5fa4eb..0000000 --- a/work/3f/a7cae8fdde157089440ff4d2e77089/input.1.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.1.fasta \ No newline at end of file diff --git a/work/3f/a7cae8fdde157089440ff4d2e77089/input.blastout b/work/3f/a7cae8fdde157089440ff4d2e77089/input.blastout deleted file mode 100644 index 8922b57..0000000 --- a/work/3f/a7cae8fdde157089440ff4d2e77089/input.blastout +++ /dev/null @@ -1 +0,0 @@ -Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.begin b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.err b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.log b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.out b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.run b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.run deleted file mode 100644 index 7be94ab..0000000 --- a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (1) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/71/0d3867a8d3b5de4fe7c5a25071f455/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/input.fasta input.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.sh b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.sh deleted file mode 100644 index 00a3ce3..0000000 --- a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.exitcode b/work/71/0d3867a8d3b5de4fe7c5a25071f455/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/71/0d3867a8d3b5de4fe7c5a25071f455/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.blastout b/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.blastout deleted file mode 100644 index 8cab1da..0000000 --- a/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.blastout +++ /dev/null @@ -1,5 +0,0 @@ -Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.fasta b/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.fasta deleted file mode 120000 index 6bfb745..0000000 --- a/work/71/0d3867a8d3b5de4fe7c5a25071f455/input.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/input.fasta \ No newline at end of file diff --git a/work/71/990da57db0c2c80bed5070f36a2644/.chunks.input.fasta b/work/71/990da57db0c2c80bed5070f36a2644/.chunks.input.fasta deleted file mode 100644 index 8f86e11ca3f2b60ac96616a5f042a0adb878df3e..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 513 zcmcJ|F%rTc5CA|a{DJS_2nmTP?d>g{OUTWj2pMu1eXF%U@BxnF8>qKfvAN(KWoGB) zAtihs-SQFJognAmF9El}VBr+g6~gpj@^L*coQWV1XO79ChxNx@1%0n9n$8Yt)Z<Scaffold_1_1..100 -CAGGCAAAATGTGGCACAAAAACAACAAATTGTTTAGTAGATACAGGGGCATCCATTTGTTGTATTTCGTCTGCTTTTCTGAGCACAGCTTTTGAAAACC diff --git a/work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta b/work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta deleted file mode 100644 index e459aa6..0000000 --- a/work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta +++ /dev/null @@ -1,2 +0,0 @@ ->Scaffold_1_101..200 -TTACTCTTGGAAACTCACCCTTTCCACAGGTAAAAGGTGTTGGCGGCGAATTGCATAAAGTGTTAGGTTCAGTTGTGTTAGATTTTGTCATTGAGGATCA diff --git a/work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta b/work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta deleted file mode 100644 index b8b2c14..0000000 --- a/work/71/990da57db0c2c80bed5070f36a2644/input.3.fasta +++ /dev/null @@ -1,2 +0,0 @@ ->Scaffold_1_201..300 -GGAATTTTCTCAAAGATTCTATGTACTGCCTACACTGCCGAAGGCAGTGATACTAGGTGAGAACTTCCTTAATGACAATGATGCAGTCTTAGATTATAGC diff --git a/work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta b/work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta deleted file mode 100644 index 732f920..0000000 --- a/work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta +++ /dev/null @@ -1,2 +0,0 @@ ->Scaffold_1_301..400 -TGTCATTCCTTGATACTCAACAACAGCACCTCAGATAGGCAATATATCAATTTCATAGCCAATTCAGTGCATGAGATTAGTGGATTAGCAAAAACACTAG diff --git a/work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta b/work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta deleted file mode 100644 index 2991afa..0000000 --- a/work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta +++ /dev/null @@ -1,2 +0,0 @@ ->Scaffold_1_401..500 -ATCAGATTTACATCCCCCCTCAGAGTGAAATTCATTTCAAGGTCAGACTATCAGAGACCAAAGAGGATTCCCTCATCCTCATTGAACCCATTGCTTCCCT diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.begin b/work/7b/a74d9f937053b223d41e8145db2861/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.err b/work/7b/a74d9f937053b223d41e8145db2861/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.log b/work/7b/a74d9f937053b223d41e8145db2861/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.out b/work/7b/a74d9f937053b223d41e8145db2861/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.run b/work/7b/a74d9f937053b223d41e8145db2861/.command.run deleted file mode 100644 index 385fd2c..0000000 --- a/work/7b/a74d9f937053b223d41e8145db2861/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (5) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/7b/a74d9f937053b223d41e8145db2861/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/7b/a74d9f937053b223d41e8145db2861/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.5.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta input.5.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/7b/a74d9f937053b223d41e8145db2861/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.command.sh b/work/7b/a74d9f937053b223d41e8145db2861/.command.sh deleted file mode 100644 index c0e0afc..0000000 --- a/work/7b/a74d9f937053b223d41e8145db2861/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.5.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/7b/a74d9f937053b223d41e8145db2861/.exitcode b/work/7b/a74d9f937053b223d41e8145db2861/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/7b/a74d9f937053b223d41e8145db2861/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/7b/a74d9f937053b223d41e8145db2861/input.5.fasta b/work/7b/a74d9f937053b223d41e8145db2861/input.5.fasta deleted file mode 120000 index e1f3506..0000000 --- a/work/7b/a74d9f937053b223d41e8145db2861/input.5.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.5.fasta \ No newline at end of file diff --git a/work/7b/a74d9f937053b223d41e8145db2861/input.blastout b/work/7b/a74d9f937053b223d41e8145db2861/input.blastout deleted file mode 100644 index 19fb367..0000000 --- a/work/7b/a74d9f937053b223d41e8145db2861/input.blastout +++ /dev/null @@ -1 +0,0 @@ -Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.begin b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.err b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.log b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.out b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.run b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.run deleted file mode 100644 index 787eb7a..0000000 --- a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.run +++ /dev/null @@ -1,103 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/8ee16d3455b4398f550baeec536ea1/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/8ee16d3455b4398f550baeec536ea1/.command.sh -} - -nxf_stage() { - true -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/8ee16d3455b4398f550baeec536ea1/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.sh b/work/7f/8ee16d3455b4398f550baeec536ea1/.command.sh deleted file mode 100644 index cc3edd4..0000000 --- a/work/7f/8ee16d3455b4398f550baeec536ea1/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB/blastDB -query /mnt/d/Work/nextflow_stuff/nftutorial/input.fasta -outfmt 6 -out input.blastout diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/.exitcode b/work/7f/8ee16d3455b4398f550baeec536ea1/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/7f/8ee16d3455b4398f550baeec536ea1/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/7f/8ee16d3455b4398f550baeec536ea1/input.blastout b/work/7f/8ee16d3455b4398f550baeec536ea1/input.blastout deleted file mode 100644 index 8cab1da..0000000 --- a/work/7f/8ee16d3455b4398f550baeec536ea1/input.blastout +++ /dev/null @@ -1,5 +0,0 @@ -Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.begin b/work/7f/c96665018e757eb6f4c0765d024062/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.err b/work/7f/c96665018e757eb6f4c0765d024062/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.log b/work/7f/c96665018e757eb6f4c0765d024062/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.out b/work/7f/c96665018e757eb6f4c0765d024062/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.run b/work/7f/c96665018e757eb6f4c0765d024062/.command.run deleted file mode 100644 index 4d8a605..0000000 --- a/work/7f/c96665018e757eb6f4c0765d024062/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (5) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/c96665018e757eb6f4c0765d024062/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/c96665018e757eb6f4c0765d024062/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.5.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta input.5.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/7f/c96665018e757eb6f4c0765d024062/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.command.sh b/work/7f/c96665018e757eb6f4c0765d024062/.command.sh deleted file mode 100644 index c0e0afc..0000000 --- a/work/7f/c96665018e757eb6f4c0765d024062/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.5.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/7f/c96665018e757eb6f4c0765d024062/.exitcode b/work/7f/c96665018e757eb6f4c0765d024062/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/7f/c96665018e757eb6f4c0765d024062/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/7f/c96665018e757eb6f4c0765d024062/input.5.fasta b/work/7f/c96665018e757eb6f4c0765d024062/input.5.fasta deleted file mode 120000 index 5cd38cf..0000000 --- a/work/7f/c96665018e757eb6f4c0765d024062/input.5.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.5.fasta \ No newline at end of file diff --git a/work/7f/c96665018e757eb6f4c0765d024062/input.blastout b/work/7f/c96665018e757eb6f4c0765d024062/input.blastout deleted file mode 100644 index 19fb367..0000000 --- a/work/7f/c96665018e757eb6f4c0765d024062/input.blastout +++ /dev/null @@ -1 +0,0 @@ -Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.begin b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.err b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.log b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.out b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.run b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.run deleted file mode 100644 index 3374abf..0000000 --- a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (4) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/8b/56e6fed73cb914f7286cd5d981894e/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/8b/56e6fed73cb914f7286cd5d981894e/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.4.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta input.4.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/8b/56e6fed73cb914f7286cd5d981894e/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.sh b/work/8b/56e6fed73cb914f7286cd5d981894e/.command.sh deleted file mode 100644 index 7626a47..0000000 --- a/work/8b/56e6fed73cb914f7286cd5d981894e/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.4.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/.exitcode b/work/8b/56e6fed73cb914f7286cd5d981894e/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/8b/56e6fed73cb914f7286cd5d981894e/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/input.4.fasta b/work/8b/56e6fed73cb914f7286cd5d981894e/input.4.fasta deleted file mode 120000 index 415c0aa..0000000 --- a/work/8b/56e6fed73cb914f7286cd5d981894e/input.4.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.4.fasta \ No newline at end of file diff --git a/work/8b/56e6fed73cb914f7286cd5d981894e/input.blastout b/work/8b/56e6fed73cb914f7286cd5d981894e/input.blastout deleted file mode 100644 index 05980cb..0000000 --- a/work/8b/56e6fed73cb914f7286cd5d981894e/input.blastout +++ /dev/null @@ -1 +0,0 @@ -Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.begin b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.err b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.log b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.out b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.run b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.run deleted file mode 100644 index be03af5..0000000 --- a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (2) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/99/3d8ec7b2376df49e34b8af5f7065e7/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.2.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta input.2.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.sh b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.sh deleted file mode 100644 index 1b99561..0000000 --- a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.2.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.exitcode b/work/99/3d8ec7b2376df49e34b8af5f7065e7/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/99/3d8ec7b2376df49e34b8af5f7065e7/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.2.fasta b/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.2.fasta deleted file mode 120000 index eca20fe..0000000 --- a/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.2.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.2.fasta \ No newline at end of file diff --git a/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.blastout b/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.blastout deleted file mode 100644 index 8868ada..0000000 --- a/work/99/3d8ec7b2376df49e34b8af5f7065e7/input.blastout +++ /dev/null @@ -1 +0,0 @@ -Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.begin b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.err b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.log b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.out b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.run b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.run deleted file mode 100644 index e3c43ef..0000000 --- a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (1) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/ba/95f5736be825ad1c7b0bd16ad91e73/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/input.fasta input.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.sh b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.sh deleted file mode 100644 index 00a3ce3..0000000 --- a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.exitcode b/work/ba/95f5736be825ad1c7b0bd16ad91e73/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/ba/95f5736be825ad1c7b0bd16ad91e73/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.blastout b/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.blastout deleted file mode 100644 index 8cab1da..0000000 --- a/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.blastout +++ /dev/null @@ -1,5 +0,0 @@ -Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.fasta b/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.fasta deleted file mode 120000 index 6bfb745..0000000 --- a/work/ba/95f5736be825ad1c7b0bd16ad91e73/input.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/input.fasta \ No newline at end of file diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.begin b/work/c4/47cf90196657efefed5587143e0906/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.err b/work/c4/47cf90196657efefed5587143e0906/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.log b/work/c4/47cf90196657efefed5587143e0906/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.out b/work/c4/47cf90196657efefed5587143e0906/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.run b/work/c4/47cf90196657efefed5587143e0906/.command.run deleted file mode 100644 index 711f7c5..0000000 --- a/work/c4/47cf90196657efefed5587143e0906/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (4) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/47cf90196657efefed5587143e0906/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/47cf90196657efefed5587143e0906/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.4.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta input.4.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/47cf90196657efefed5587143e0906/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/c4/47cf90196657efefed5587143e0906/.command.sh b/work/c4/47cf90196657efefed5587143e0906/.command.sh deleted file mode 100644 index 7626a47..0000000 --- a/work/c4/47cf90196657efefed5587143e0906/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.4.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/c4/47cf90196657efefed5587143e0906/.exitcode b/work/c4/47cf90196657efefed5587143e0906/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/c4/47cf90196657efefed5587143e0906/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/c4/47cf90196657efefed5587143e0906/input.4.fasta b/work/c4/47cf90196657efefed5587143e0906/input.4.fasta deleted file mode 120000 index cc53fa4..0000000 --- a/work/c4/47cf90196657efefed5587143e0906/input.4.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.4.fasta \ No newline at end of file diff --git a/work/c4/47cf90196657efefed5587143e0906/input.blastout b/work/c4/47cf90196657efefed5587143e0906/input.blastout deleted file mode 100644 index 05980cb..0000000 --- a/work/c4/47cf90196657efefed5587143e0906/input.blastout +++ /dev/null @@ -1 +0,0 @@ -Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.begin b/work/c4/591e87d704c57904782d621fa23dac/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.err b/work/c4/591e87d704c57904782d621fa23dac/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.log b/work/c4/591e87d704c57904782d621fa23dac/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.out b/work/c4/591e87d704c57904782d621fa23dac/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.run b/work/c4/591e87d704c57904782d621fa23dac/.command.run deleted file mode 100644 index a5c2d75..0000000 --- a/work/c4/591e87d704c57904782d621fa23dac/.command.run +++ /dev/null @@ -1,103 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/591e87d704c57904782d621fa23dac/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/591e87d704c57904782d621fa23dac/.command.sh -} - -nxf_stage() { - true -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/c4/591e87d704c57904782d621fa23dac/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/c4/591e87d704c57904782d621fa23dac/.command.sh b/work/c4/591e87d704c57904782d621fa23dac/.command.sh deleted file mode 100644 index 772cd69..0000000 --- a/work/c4/591e87d704c57904782d621fa23dac/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query /mnt/d/Work/nextflow_stuff/nftutorial/input.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/c4/591e87d704c57904782d621fa23dac/.exitcode b/work/c4/591e87d704c57904782d621fa23dac/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/c4/591e87d704c57904782d621fa23dac/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/c4/591e87d704c57904782d621fa23dac/input.blastout b/work/c4/591e87d704c57904782d621fa23dac/input.blastout deleted file mode 100644 index 8cab1da..0000000 --- a/work/c4/591e87d704c57904782d621fa23dac/input.blastout +++ /dev/null @@ -1,5 +0,0 @@ -Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_201..300 Scaffold_1_201..300 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_301..400 Scaffold_1_301..400 100.000 100 0 0 1 100 1 100 4.90e-52 185 -Scaffold_1_401..500 Scaffold_1_401..500 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.begin b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.err b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.log b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.out b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.run b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.run deleted file mode 100644 index 3e1e816..0000000 --- a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (1) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/c9/0188819dd55c40e3180e3fa3a02541/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/c9/0188819dd55c40e3180e3fa3a02541/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.1.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.1.fasta input.1.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/c9/0188819dd55c40e3180e3fa3a02541/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.sh b/work/c9/0188819dd55c40e3180e3fa3a02541/.command.sh deleted file mode 100644 index ef144d5..0000000 --- a/work/c9/0188819dd55c40e3180e3fa3a02541/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.1.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/.exitcode b/work/c9/0188819dd55c40e3180e3fa3a02541/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/c9/0188819dd55c40e3180e3fa3a02541/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/input.1.fasta b/work/c9/0188819dd55c40e3180e3fa3a02541/input.1.fasta deleted file mode 120000 index f80d8bf..0000000 --- a/work/c9/0188819dd55c40e3180e3fa3a02541/input.1.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/work/71/990da57db0c2c80bed5070f36a2644/input.1.fasta \ No newline at end of file diff --git a/work/c9/0188819dd55c40e3180e3fa3a02541/input.blastout b/work/c9/0188819dd55c40e3180e3fa3a02541/input.blastout deleted file mode 100644 index 8922b57..0000000 --- a/work/c9/0188819dd55c40e3180e3fa3a02541/input.blastout +++ /dev/null @@ -1 +0,0 @@ -Scaffold_1_1..100 Scaffold_1_1..100 100.000 100 0 0 1 100 1 100 4.90e-52 185 diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.begin b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.begin deleted file mode 100644 index e69de29..0000000 diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.err b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.err deleted file mode 100644 index e69de29..0000000 diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.log b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.log deleted file mode 100644 index e69de29..0000000 diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.out b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.out deleted file mode 100644 index e69de29..0000000 diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.run b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.run deleted file mode 100644 index cdfc3b0..0000000 --- a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.run +++ /dev/null @@ -1,106 +0,0 @@ -#!/bin/bash -# NEXTFLOW TASK: runBlast (2) -set -e -set -u -NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x -NXF_ENTRY=${1:-nxf_main} - - -nxf_date() { - local ts=$(date +%s%3N); - if [[ ${#ts} == 10 ]]; then echo ${ts}000 - elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000} - elif [[ $ts == *3N ]]; then echo ${ts/3N/000} - elif [[ ${#ts} == 13 ]]; then echo $ts - else echo "Unexpected timestamp value: $ts"; exit 1 - fi -} - -nxf_env() { - echo '============= task environment =============' - env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/" - echo '============= task output ==================' -} - -nxf_kill() { - declare -a children - while read P PP;do - children[$PP]+=" $P" - done < <(ps -e -o pid= -o ppid=) - - kill_all() { - [[ $1 != $$ ]] && kill $1 2>/dev/null || true - for i in ${children[$1]:=}; do kill_all $i; done - } - - kill_all $1 -} - -nxf_mktemp() { - local base=${1:-/tmp} - if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX - else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX - fi -} - -on_exit() { - exit_status=${nxf_main_ret:=$?} - printf $exit_status > /mnt/d/Work/nextflow_stuff/nftutorial/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode - set +u - [[ "$tee1" ]] && kill $tee1 2>/dev/null - [[ "$tee2" ]] && kill $tee2 2>/dev/null - [[ "$ctmp" ]] && rm -rf $ctmp || true - exit $exit_status -} - -on_term() { - set +e - [[ "$pid" ]] && nxf_kill $pid -} - -nxf_launch() { - /bin/bash -ue /mnt/d/Work/nextflow_stuff/nftutorial/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.sh -} - -nxf_stage() { - true - # stage input files - rm -f input.2.fasta - ln -s /mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta input.2.fasta -} - -nxf_unstage() { - true - [[ ${nxf_main_ret:=0} != 0 ]] && return -} - -nxf_main() { - trap on_exit EXIT - trap on_term TERM INT USR2 - trap '' USR1 - - [[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR" - NXF_SCRATCH='' - [[ $NXF_DEBUG > 0 ]] && nxf_env - touch /mnt/d/Work/nextflow_stuff/nftutorial/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.begin - set +u - set -u - [[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH - nxf_stage - - set +e - local ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR) - local cout=$ctmp/.command.out; mkfifo $cout - local cerr=$ctmp/.command.err; mkfifo $cerr - tee .command.out < $cout & - tee1=$! - tee .command.err < $cerr >&2 & - tee2=$! - ( nxf_launch ) >$cout 2>$cerr & - pid=$! - wait $pid || nxf_main_ret=$? - wait $tee1 $tee2 - nxf_unstage -} - -$NXF_ENTRY diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.sh b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.sh deleted file mode 100644 index 1b99561..0000000 --- a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.command.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -ue -blastn -num_threads 2 -db /mnt/d/Work/nextflow_stuff/nftutorial/DB//blastDB -query input.2.fasta -outfmt '6' -evalue 1e-3 -out input.blastout diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode deleted file mode 100644 index c227083..0000000 --- a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/.exitcode +++ /dev/null @@ -1 +0,0 @@ -0 \ No newline at end of file diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.2.fasta b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.2.fasta deleted file mode 120000 index c5cca71..0000000 --- a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.2.fasta +++ /dev/null @@ -1 +0,0 @@ -/mnt/d/Work/nextflow_stuff/nftutorial/work/20/a023d9c641eb2e9b732797e1a39b21/input.2.fasta \ No newline at end of file diff --git a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.blastout b/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.blastout deleted file mode 100644 index 8868ada..0000000 --- a/work/f7/f59d4a6ae31cd0b0eb8cb7b6857b78/input.blastout +++ /dev/null @@ -1 +0,0 @@ -Scaffold_1_101..200 Scaffold_1_101..200 100.000 100 0 0 1 100 1 100 4.90e-52 185 From 7e76f768a49432d6cc9d964da6a57097c894f37c Mon Sep 17 00:00:00 2001 From: Flip Mulder Date: Fri, 26 Feb 2021 08:34:20 +0100 Subject: [PATCH 6/6] Adding stuff to branch: new3 --- dirlisting | 8 ++++++++ 1 file changed, 8 insertions(+) create mode 100644 dirlisting diff --git a/dirlisting b/dirlisting new file mode 100644 index 0000000..db7eeb0 --- /dev/null +++ b/dirlisting @@ -0,0 +1,8 @@ +DB +README.md +dirlisting +input.fasta +main.nf +nextflow.config +out_dir +test