diff --git a/DB/blastDB.nhr b/DB/blastDB.nhr
new file mode 100644
index 0000000..15d8333
Binary files /dev/null and b/DB/blastDB.nhr differ
diff --git a/DB/blastDB.nin b/DB/blastDB.nin
new file mode 100644
index 0000000..f3e3fbb
Binary files /dev/null and b/DB/blastDB.nin differ
diff --git a/DB/blastDB.nsq b/DB/blastDB.nsq
new file mode 100644
index 0000000..e3a56cd
Binary files /dev/null and b/DB/blastDB.nsq differ
diff --git a/dirlisting b/dirlisting
new file mode 100644
index 0000000..db7eeb0
--- /dev/null
+++ b/dirlisting
@@ -0,0 +1,8 @@
+DB
+README.md
+dirlisting
+input.fasta
+main.nf
+nextflow.config
+out_dir
+test
diff --git a/input.fasta b/input.fasta
new file mode 100644
index 0000000..fdc0c85
--- /dev/null
+++ b/input.fasta
@@ -0,0 +1,10 @@
+>Scaffold_1_1..100
+CAGGCAAAATGTGGCACAAAAACAACAAATTGTTTAGTAGATACAGGGGCATCCATTTGTTGTATTTCGTCTGCTTTTCTGAGCACAGCTTTTGAAAACC
+>Scaffold_1_101..200
+TTACTCTTGGAAACTCACCCTTTCCACAGGTAAAAGGTGTTGGCGGCGAATTGCATAAAGTGTTAGGTTCAGTTGTGTTAGATTTTGTCATTGAGGATCA
+>Scaffold_1_201..300
+GGAATTTTCTCAAAGATTCTATGTACTGCCTACACTGCCGAAGGCAGTGATACTAGGTGAGAACTTCCTTAATGACAATGATGCAGTCTTAGATTATAGC
+>Scaffold_1_301..400
+TGTCATTCCTTGATACTCAACAACAGCACCTCAGATAGGCAATATATCAATTTCATAGCCAATTCAGTGCATGAGATTAGTGGATTAGCAAAAACACTAG
+>Scaffold_1_401..500
+ATCAGATTTACATCCCCCCTCAGAGTGAAATTCATTTCAAGGTCAGACTATCAGAGACCAAAGAGGATTCCCTCATCCTCATTGAACCCATTGCTTCCCT
diff --git a/main.nf b/main.nf
index 7f65404..31a169b 100644
--- a/main.nf
+++ b/main.nf
@@ -1,6 +1,56 @@
 #! /usr/bin/env nextflow
 
-blastdb="myBlastDatabase"
-params.query="file.fasta"
+println "\nI want to BLAST $params.query to $params.dbDir/$params.dbName using $params.threads CPUs and output it to $params.outdir"
+
+def helpMessage() {
+  log.info """
+        Usage:
+        The typical command for running the pipeline is as follows:
+        nextflow run main.nf --query QUERY.fasta --dbDir "blastDatabaseDirectory" --dbName "blastPrefixName"
+
+        Mandatory arguments:
+         --query                        Query fasta file of sequences you wish to BLAST
+         --dbDir                        BLAST database directory (full path required)
+         --dbName                       Prefix name of the BLAST database
+
+       Optional arguments:
+        --outdir                       Output directory to place final BLAST output
+        --outfmt                       Output format ['6']
+        --options                      Additional options for BLAST command [-evalue 1e-3]
+        --outFileName                  Prefix name for BLAST output [input.blastout]
+        --threads                      Number of CPUs to use during blast job [16]
+        --chunkSize                    Number of fasta records to use when splitting the query fasta file
+        --app                          BLAST program to use [blastn;blastp,tblastn,blastx]
+        --help                         This usage statement.
+        """
+}
+
+// Show help message
+if (params.help) {
+    helpMessage()
+    exit 0
+}
+
+Channel
+      .fromPath(params.query)
+      .splitFasta(by: 1, file:true)
+      .set { queryFile_ch }
+
+process runBlast {
+
+  input:
+    path(queryFile) from queryFile_ch
+
+  output:
+    path(params.outFileName) into blast_output_ch
+ 
+  script:
+  """
+  blastn  -num_threads $params.threads -db $params.dbDir/$params.dbName -query $queryFile -outfmt $params.outfmt $params.options -out $params.outFileName
+  """
+
+}
+
+blast_output_ch
+  .collectFile(name: 'blast_output_combined.txt', storeDir: params.outdir)
 
-println "I will BLAST $params.query against $blastdb"
diff --git a/nextflow.config b/nextflow.config
index e69de29..a2b7c7e 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -0,0 +1,11 @@
+params {
+  query = "$PWD/input.fasta"
+  dbDir = "$PWD/DB/"
+  dbName = "blastDB"
+  threads = 2
+  outdir = "out_dir"
+  outFileName = "input.blastout"
+  options = "-evalue 1e-3"
+  outfmt = "'6'"
+  help = false
+}
\ No newline at end of file
diff --git a/out_dir/blast_output_combined.txt b/out_dir/blast_output_combined.txt
new file mode 100644
index 0000000..4fadc77
--- /dev/null
+++ b/out_dir/blast_output_combined.txt
@@ -0,0 +1,5 @@
+Scaffold_1_401..500	Scaffold_1_401..500	100.000	100	0	0	1	100	1	100	4.90e-52	185
+Scaffold_1_301..400	Scaffold_1_301..400	100.000	100	0	0	1	100	1	100	4.90e-52	185
+Scaffold_1_201..300	Scaffold_1_201..300	100.000	100	0	0	1	100	1	100	4.90e-52	185
+Scaffold_1_101..200	Scaffold_1_101..200	100.000	100	0	0	1	100	1	100	4.90e-52	185
+Scaffold_1_1..100	Scaffold_1_1..100	100.000	100	0	0	1	100	1	100	4.90e-52	185
diff --git a/out_dir/blastout/input.blastout b/out_dir/blastout/input.blastout
new file mode 120000
index 0000000..8dc94f0
--- /dev/null
+++ b/out_dir/blastout/input.blastout
@@ -0,0 +1 @@
+/mnt/d/Work/nextflow_stuff/nftutorial/work/7f/c96665018e757eb6f4c0765d024062/input.blastout
\ No newline at end of file
diff --git a/test/test.txt b/test/test.txt
new file mode 100644
index 0000000..610f2cb
--- /dev/null
+++ b/test/test.txt
@@ -0,0 +1 @@
+Content of test.txt
diff --git a/test/test2.txt b/test/test2.txt
new file mode 100644
index 0000000..e69de29