New locus? CEL VNTR variant - monogenic diabetes

[hdashnow]

https://omim.org/entry/609812#molecularGenetics

chrome-extension://efaidnbmnnnibpcajpcglclefindmkaj/https://www.pfmjournal.org/upload/pdf/pfm-2021-00100.pdf

[Macayla-weiner]

I'm not seeing anything about the proposed "mutations" other than that they are there. Am I missing something?

[hdashnow]

It's a proposed VNTR disease variant https://omim.org/entry/609812#molecularGenetics

[Macayla-weiner]

Okay so what I'm understanding is monogenic diabetes (more specifically MODY) is associated with a single base deletion of the normal 7-23 33 bp repeats on CEL in in exon 11 of chromosome 9. Length might affect penetrance? As seen by the individual with a novel 3-repeats. It's autosomal dominant and seen in a good handful of patients. Oh and MODY may be comorbid with FED. What I'm not seeing is what the repeat actually is or where it is, let me know if I've misunderstood or missed something else. (Raeder et al. (2006) and Torsvik et al. (2010))

edit: specifically chromosome 9q34 so if we can get coordinates from that I'm happy to add it to STRchive but I son't know how to get that

[hdashnow]

Here are the proposed hg38 coorinates from collaborator @bw2
9:133071170-133071728

They are from this resource:
https://github.com/mehrdadbakhtiari/adVNTR/wiki/Disease-linked-VNTRs

But I'm not sure where they got the coordinates from, so we'll need to independently verify them.

[hdashnow]

Here are the 9q34 coordintes, but they're much wider!
https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&cytoBand=pack&position=chr9:127500001-138394717&hgFind.matches=9q34

[Macayla-weiner]

Perfect! Does the rest of the information I've pulled look accurate?

[hdashnow]

This figure narrows it down to CEL exon 11, the last exon.
https://www.nature.com/articles/ng1708/figures/2

That's hg38 chr9:133,070,986-133,071,766, so consistent with the coordintes above.

I'm comfortable with using hg38 chr9:133071170-133071728 as a starting point.

And yes, your summary is good. I'd add that there appear to be two types of mutations at this locus:

1. Single bp deletion (which effectively changes the motif)
2. Contraction from 4 to 3 VNTR repeats may be pathogenic with reduced penentrance, but it seems like the evidence for this is less clear.

[Macayla-weiner]

I'm going to go ahead and add it with the lit review PR!

[hdashnow]

Will be added in #248

[Macayla-weiner]

Will actually be added in #252

[hdashnow]

@Macayla-weiner and I have been reviewing UCSC and two papers describing MODY8 patients with CEL variants. I'm going to summarize what we found so far here:

Wider VNTR region called by TRF in hg19

Simple Tandem Repeat Information
Period: 33
Copies: 15.9
Consensus size: 33
Match Percentage: 93%
Insert/Delete Percentage: 1%
Score: 847
Entropy: 1.620
Sequence: GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG
Position: chr9:135946557-135947081
Band: 9q34.2
Genomic Size: 525

However, the "pure" region of this motif is less than half that size. We need to decide how big to make the locus.

From attempting to manually read the Sanger trace in Figure 2f of https://www.nature.com/articles/ng1708

Family 1 sequence:
GAGGCCACCCC, then the deletion of a T at hg19 position chr9:135,946,566 (hg19)

This is at the left-most end of the VNTR as it is annotated by TRF, and the motifs are not very close to the typical motif at this position, so it's hard to describe as a VNTR variant.

Family 2 sequence:
GTGCCGCCCACGGGTGACTCCGGGGCCCCCCC then a deletion of C, so a change from (C)8 to (C)7 within the VNTR motif, which we've coded as:

  "reference_motif_reference_orientation": ["GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG"],
  "pathogenic_motif_reference_orientation": ["GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG"],

This reference motif occurs at least 4 times, so we should check which motif was affected if known in the paper.

We also looked at the two CEL varients reported in this paper: https://link.springer.com/article/10.1007/s13353-024-00907-7
Table 1, cases 5 and 7.

This variant is in the VNTR, in exon 11
9:135,946,930
Need to confirm that this is a different variant from the two described above, and if it can be easily represented as a motif change.

This variant is NOT in the VNTR. It is in exon 5
9:135,941,957